... consent was not obtained from patients because this study was part of an ICU quality assurance program For each CXR performed (routine and non-routine), the clinical fellow completed a data sheet ... Vascular 1 Congestive heart failure Other Myocardial infarction Respiratory failure Cardiac arrest Sepsis Other Post-partum complications 10 Cardiovascular (congestive heart failure, cardiac arrest) ... arrest) Gastrointestinal complications* Other Sepsis Cardiovascular Gastrointestinal Gastrointestinal bleeding Liver failure/cirrhosis review Acute COPD exacerbation Gastrointestinal commentary Respiratory...
Ngày tải lên: 25/10/2012, 10:45
... similar to aromatic DNA-intercalating agents Although DNA is the most important biological assembly stabilized by aromatic interactions [56], a diverse group of planar aromatic compounds can intercalate ... information of the role of aromatic moieties in amyloid fibril formation [36–41] A parameter-free model based on the mathematical analysis of many peptide fragments and their analogues had clearly ... similar cytotoxic activity showed, for the first time, that a peptide as small as a hexapeptide can form a well-ordered and functional amyloid structure The authors then realized that even a pentapeptide...
Ngày tải lên: 23/03/2014, 11:20
báo cáo sinh học:" Development of a quality assurance handbook to improve educational courses in Africa" docx
... defined penalties for plagiarism and collusion Quality assurance of approval and review processes Aim To maintain the academic quality of courses and ensure that courses remain relevant in the ... reviewed documents that focused on quality assurance strategies internationally, in particular in Africa, from World Bank and African institutional web sites as well as published literature [8-12,18-23] ... Education: United Kingdom Mansfield 1997 [http://www.qaa.ac.uk] (accessed 26/11/2008) Bates I, Ansong D, Bedu-Addo G, Agbenyega T, Akoto AYO, NsiahAsare A, Karikari P: Evaluation of a learner-designed...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo y học: " Percentile benchmarks in patients with rheumatoid arthritis: Health Assessment Questionnaire as a quality indicator" pot
... measurements and involving all stages of disease and a demographically broad sample Prospective rather than cross-sectional measurements have important advantages, in guarding against cohort bias (differences ... population was Gaussian The mean (standard deviation) overall HAQ-DI was 1.27 (0.82) Interestingly, 249 patients (4%) had no disability at all revealed in any of their observations Table Baseline ... patient group in a rheumatology practice? The available literatures have been based on a posteriori analyses of data from randomized, controlled trials and small, qualitative research Figure arthritis...
Ngày tải lên: 09/08/2014, 01:24
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pot
... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... Qualitative Research Thousand Oaks, CA: Sage Publications; 2006 Patton M: Qualitative Research and Evaluation Methods Thousand Oaks, CA: Sage Publications; 2002 Logan J, Graham ID: Toward a comprehensive...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " Mapping as a knowledge translation tool for Ontario Early Years Centres: views from data analysts and managers" pps
... participated (representing eight teams; two of the eight teams have two data analysts and one manager, and the other six teams have one data analyst and one manager) Initially, twelve OEYC data analyst/manager ... analyst/manager dyads were asked to participate and four declined The reasons given for declining included vacancies in the data analyst position, and already having access to a commercial GIS tool Data ... Qualitative Research Thousand Oaks, CA: Sage Publications; 2006 Patton M: Qualitative Research and Evaluation Methods Thousand Oaks, CA: Sage Publications; 2002 Logan J, Graham ID: Toward a comprehensive...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
... Intensive Care Med 2004, 30:996-997 doi:10.1186/cc8189 Cite this article as: Aardema LM, et al.: Value and price of ventilator-associated pneumonia surveillance as a quality indicator Critical Care ... References Klompas M: Unintended consequences in the drive for zero Thorax 2009, 64:463-465 Klompas M: The paradox of ventilator-associated pneumonia prevention measures Crit Care 2009, 13:315 ... in the acute care setting Am J Infect Control 2008, 36:309-332 Tulleken JE, Zijlstra JG, Ligtenberg JJ, Spanjersberg R, Van der Werf TS: Ventilator-associated pneumonia: caveats for benchmarking...
Ngày tải lên: 13/08/2014, 20:21
Creating Your CV as a self Marketing Tool
... States and Canada it is generally called a Resume, but the contents remain the same and need to capture a number of key areas, including: • A Personal Proile Statement • Roles undertaken, clearly ... naturally born sales persons and on many occasions feel embarrassed and uncomfortable about talking about themselves he book will show how to overcome these as far as capturing information on paper is ... the ad to read more Creating your CV as a self marketing tool About the Author About the Author Paul H Brisk started his career in December 1969 in Leeds, as a junior clerk for the Halifax Building...
Ngày tải lên: 09/08/2016, 13:00
báo cáo hóa học:" Engagement of patients in religious and spiritual practices: Confirmatory results with the SpREUK-P 1.1 questionnaire as a tool of quality of life research" ppt
... Gender andMarital status are covariates only for ExP • Age is not a relevant covariate for any of the five forms of SpR practice • Disease itself has an impact on NoP (and a minor impact on HuP and ... that an R-S- attitude was associated with the lowest engagement scores for all five forms of a SpR practice Variance analyses confirmed that SpR attitude and religious affiliation are the main ... Analyses of variance Next we tested the impact of several variables on the SpREUK P sub-scales, such as age, sex, marital status, educational level, religious affiliation, SpR attitude, disease...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo y học: "Validation of a specific measure to assess healthrelated quality of life in patients with schizophrenia and bipolar disorder: the ‘Tolerability and quality of life’ (TOOL) questionnaire" doc
... Hospital del Henares, Coslada, Madrid, Spain 3BAP Health Outcomes Research, Oviedo, Spain 4Value Demonstration Unit, AstraZeneca Medical Department, Madrid, Spain 5Neuroscience Area, AstraZeneca ... Uriarte, and Fermín Mayoral for their contribution in the linguistic validation Author details Department of Psychiatry, Hospital Universitario de Salamanca, Salamanca, Spain 2Department of Psychiatry, ... ‘TOlerability and quality Of Life’ (TOOL) questionnaire Acknowledgements This study was funded by AstraZeneca Medical Department Spain The authors would like to thank Aurelio Garc a, Juan José Uriarte,...
Ngày tải lên: 09/08/2014, 01:21
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... Government Health Directorate Ruth Thomas was funded by the Wellcome Trust (GR0673790AIA) Bernard Croal was supported by a grant from Grampian Endowments Jeremy Grimshaw holds a Canada Research Chair ... information system This data are routinely collected and ascribed to the primary care practice and could not accurately be attributed to individual primary care doctors Statistical analysis In all...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children" ppt
... check the equality of variance assumption Internal consistency of the scale was evaluated using Cronbach’s alpha As for validity analysis, the diagnostic assessment of depression and anxiety by ... the AYMH scale has reasonably good construct validity and internal consistency However, the scale has moderate discriminatory capabilities as a diagnostic tool for depression and anxiety Compared ... this article as: Mahfoud et al.: Validation of the Arab Youth Mental Health scale as a screening tool for depression/anxiety in Lebanese children Child and Adolescent Psychiatry and Mental Health...
Ngày tải lên: 13/08/2014, 18:21
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... 70 AACVPR: Guidelines for Cardiac Rehabilitation and Secondary Prevention Programs 4th Edition edition American Association of Cardiovascular and Pulmonary Rehabilitation Champaigh, IL.: Human ... de Gaia: APOGESD; 2007 CDC: Physical Activity Evaluation Handbook Centers for Disease Control and Prevention Atlanta; 2002b NHS: Exercise Referral Systems: A National Quality Assurance Framework...
Ngày tải lên: 14/08/2014, 08:20
Development of high speed video imaging as a process analytical technology (PAT) tool
... concept of a visiometric process analyzer is proposed A visiometric process analyzer is defined as a process analyzer that uses imaging and image analysis to obtain process related information A visiometric ... process analyzers Current process analyzers for pharmaceutical processing can be classified into two types: process analyzers for measuring the end product quality attributes and process analyzers ... Compared to traditional tablets, multiparticulates have advantages of lower gastric irritation, more uniform gastric transit time and less variation in drug release profiles (Hogan, 1995) Ease...
Ngày tải lên: 11/09/2015, 10:00
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly
... pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than the regular aroma sample ... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... a small food reward after the last evaluation session Samples The sample material was a fermented oat bran product (Yosaw, Bioferme, Finland), which is a cereal-based snack food similar to flavored...
Ngày tải lên: 03/04/2013, 21:06
Tài liệu Speaking as a Marketing Tool ppt
... Plan Marketing - www.actionplan.com Speaking as a Marketing Tool 11 Robert Middleton Interviews Vickie Sullivan speaking as a marketing tool can really create some wonderful and qualified leads ... you, that’s a clue That’s a clue that they are not taking this seriously, that they are not going to help you and you can always back out You can always say, “I am so thrilled that you are pleased ... death because when you say speaker that has such a connotation that they start turning you off You don’t say, “I’m an author, I’m a speaker, I’m a business coach,” you say, “I am a strategic advisor...
Ngày tải lên: 16/01/2014, 22:20
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx
... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...
Ngày tải lên: 19/02/2014, 12:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc
... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...
Ngày tải lên: 21/02/2014, 03:20
Guidance for Industry PAT — A Framework for Innovative Pharmaceutical Development, Manufacturing, and Quality Assurance pdf
... efficiency PAT Tools There are many tools available that enable process understanding for scientific, risk-managed pharmaceutical development, manufacture, and quality assurance These tools, when ... implementation To facilitate adoption or approval of a PAT process, manufacturers may request a preoperational review of a PAT manufacturing facility and process by the PAT Team (see ORA Field Management ... noninvasive Process analyzers typically generate large volumes of data Certain data are likely to be relevant for routine quality assurance and regulatory decisions In a PAT environment, batch...
Ngày tải lên: 18/03/2014, 00:20