private ordering as a conceptual basis for family law

... characteristics of a Social enterprise The rationale of governing a private university as a Social Enterprise is validated by this analysis Figure 2 Facet-based mapping of Private University as a social enterprise ... Trang 67 SUCCESS PARADIGM FOR PRIVATE UNIVERSITY AS A SOCIAL ENTERPRISE The creation of social value and lasting social impact are indicators of the success of a Social enterprise (Dawans & ... success and sustainability of a private university governed as a social enterprise Analysis of the proposed framework for managing a private university as Social Enterprise is undertaken Challenges

Ngày tải lên: 09/07/2020, 02:12

... orientation makes systemic grammars more immediately useful t h a n , for example, tramffotmationai generatb,+ grammars or even procedurally oriented AI fogmali-qa~s | o f language such as ATN's ... means a deficit The p ~ c ~ l u r a l machinery that generative grammars have traditionally carried with them to characterize relations like that of active to passive has only gotten in the way ... Mam,dzm~tm at Amherst I ~ m n c t Tree A d j ~ g Grammars, or "TAG's', (Josh/, Levy & Takahash/ 1975; Josh/ 1983; Kroch & Josh/ 1965) w e ~ developed as an al~ma~ive to the aandard

Ngày tải lên: 24/03/2014, 02:20

... type of payment, you must have available, or be able to provide, the basic bank account information located at the bottom of a check: bank account number, bank (or American Banking Association) ... orders payable in one of the acceptable currencies below must be drawn on a bank in the same country as the currency For example, a check written in Australian dollars must be drawn on a bank in Australia ... Integrity ACCEPTABLE PRIMARY IDENTIFICATION DOCUMENTS Testing in Bangladesh, India, and Pakistan  All test takers in Bangladesh, India, and Pakistan MUST use valid passports as their ID documents

Ngày tải lên: 25/03/2014, 10:41

... type diabetes subjects Immunogenetics 2010, 62:101-107 36 Kawasaki E, Awata T, Ikegami H, Kobayashi T, Maruyama T, Nakanishi K, Shimada A, Uga M, Kurihara S, Kawabata Y, et al: Genetic association ... Pediatr Res 2000, 48:6-11 19 Bernasconi A, Marino R, Ribas A, Rossi J, Ciaccio M, Oleastro M, Ornani A, Paz R, Rivarola MA, Zelazko M, Belgorosky A: Characterization of immunodeficiency in a patient ... Cobbold S, Alyanakian MA, Gouarin C, Barriot S, Garcia C, Waldmann H, Bach JF, Chatenoud L: Autoimmune diabetes onset results from qualitative rather than quantitative age-dependent changes in pathogenic

Ngày tải lên: 18/06/2014, 16:20

... Vietnam, and the government has designated cashew development as a national priority. The area growing cashew is about 430000 ha located in Central Highlands, South Central Coast and South East ... 2004). Based on the successful examples on citrus orchards in the Mekong Delta (Vietnam) and on cashew orchards in Australia and Africa, this project was proposed with the aim of increasing cashew ... small holders, having about 2 ha of orchards with the average tree age being 6 years (for grafted materials) and 12 years (for trees produced from seeds) (Table 1). Cashew nut yield was about

Ngày tải lên: 21/06/2014, 05:20

... same cashew orchards as we did five months ago in Dong Nai, Ba Ria Vung Tau and Binh Phuoc The orchard in Ba Ria-Vung Tau was sprayed by the orchard owner, which was unexpected The data obtained ... Email: lphlan@yahoo.com Trang 32 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew ... the crematogaster ant, Crematogaster sp with large numbers occupying one third of the trees in the IPM plot, and the small black ant, Tapinoma melanocephalum, that was abundant on the remaining

Ngày tải lên: 21/06/2014, 06:20

... Vietnam Trang 42 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has increased ... strategy (weaver ants, pruning and light-trapping) to manage the branch borer that has been one of the major concerns by all cashew growers in Vietnam He has already passed this knowledge to IAS project ... VietnamVietnamese Project Team Leader Mr La Pham Lan Australian Organisation Charles Darwin University Australian Personnel Prof Keith Christian and Dr Renkang Peng Completion date (original)

Ngày tải lên: 21/06/2014, 06:20

... each of which was divided into two plots: a farmer’s plot that was managed with chemical insecticides, and an IPM plot that was managed by using the weaver ants (Oecophylla smaragdina) The field ... experimental data analyses, on each monitoring occasion, two plots (farmer and IPM) were ranked, based on mean percentage damage by each major pest All the monitoring occasions in the flowering and ... or/and floral flushing terminals) and the number of freshly damaged shoots by each major pest, and percent damage was calculated The cashew yields were measured in each plot one week before harvest

Ngày tải lên: 21/06/2014, 06:20

... methods and skills, and their understanding of the cashew IPM program A lot of farmers said that it was the best training they had received about cashews Although weaver ants are abundant, the farmers ... master trainers did their best to pass their knowledge to the TOT trainees A final examination at the end of each TOT training was held, and all the TOT trainees successfully passed their examinations ... know natural enemies before the FFS training, but now they can recognise several important natural enemy species, such as weaver ants, ladybirds, preying mantis and wasps Trang 5Introduction Based

Ngày tải lên: 21/06/2014, 06:20

... Information using weaver ants as a major component for cashew growers in Vietnam Feb 2006 – Apr 2009 (completion report) Contact Officer(s) In Australia: Team Leader Organisation Charles Darwin ... profit was achieved in the ICI plots A manual about the integrated cashew improvement (ICI) program using weaver ants as a major component has been developed for ICI program trainers and extension ... using weaver ants as a major component – photo book for cashew growers in Vietnam” has also been developed It covers • cashew variety selection, • advanced farming practice, • major diseases,

Ngày tải lên: 21/06/2014, 06:20

... pvbien@hcmc.netnam.vn Trang 31 Project Abstract Cashew is a very important crop in Vietnam, and the government has designated cashew development as a national priority Productivity of cashew has been increased ... started Baseline data of the insect pest assemblage and their damage were obtained Regular monitoring and sampling of insect pests and their natural enemies in the demonstration orchards has ... monitoring all the activities, and he is also responsible for the implementation of the IPM program, for the part of the TOT training and for the field data analyses Dr Pham Van Bien and Mr La Pham Lan

Ngày tải lên: 21/06/2014, 06:20

... has designated cashew development as a national priority The area growing cashew is about 430000 ha located in Central Highlands, South Central Coast and South East region Cashew is planted mainly ... integrated cashew improvement (ICI) program using weaver ants as a major component -Manual for ICI program trainers and extension officers in Vietnam” As planned, the manual includes up-to-date information ... examples on citrus orchards in the Mekong Delta (Vietnam) and on cashew orchards in Australia and Africa, this project was proposed with the aim of increasing cashew yield and improving nut quality

Ngày tải lên: 22/06/2014, 12:20

... TAGGTGCATATAAACAAGAAGTA ADAMTS-1 GCTGCCCTCACACTGCGGAAC 264 CATCATGGGGCATGTTAAACAC ADAMTS-4 GCGCCCGCTTCATCACTG 101 TTGCCGGGGAAGGTCACG ADAMTS-5 AAGCTGCCGGCCGTGGAAGGAA 196 TGGGTTATTGCAGTGGCGGTAGG ADAMTS-8 ... Hydroxypro-line release was assayed as a measure of collagen degrada-tion, and glycosaminoglycan release was assayed as a measure of proteoglycan degradation [20] Collagenase and inhibitor activities ... ATAGTGATCAGGGCCAAAGCAGTC 277 TGTCCCAGGGCACGATGAAGTC TIMP-3 GATGTACCGAGGATTCACCAAGAT 356 GCCGGATGCAAGCGTAGT TIMP-4 ATATTTATACGCCTTTTGATTCCT 297 GGTACCCGTAGAGCTTCCGTTCC TCGTCCACCCCACCCTTGATG TAGGTGCATATAAACAAGAAGTA

Ngày tải lên: 09/08/2014, 08:22

... non-insecticidal Bt isolates resulting in a new cate-gory of Bt parasporal protein called parasporin Para-sporins are defined as bacterial parasporal proteins that are capable of preferentially killing cancer ... human leukaemic T cells Methods: Bt18 parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system and antibody was raised against the purified 68-kDa parasporal ... bovine serum albumin (BSA) as standard Separation of Bt18 parasporal protein The trypsin activated parasporal protein was separated using Mono Q anion exchange column attached to a HPLC system

Ngày tải lên: 10/08/2014, 05:21

... Trang 1R E S E A R C H Open Accessδ-valerolactone and poly (ethylene glycol) as a competent vector for doxorubicin delivery against cancer Lekha Nair K1, Sankar Jagadeeshan2, S Asha Nair2and ... with a mean diameter of 90 nm and high encapsulation efficiency showing a pH dependent sustained doxorubicin release Biological evaluation in breast adenocarcinoma (MCF7) and glioblastoma (U87MG) ... Poojappura, Thiruvananthapuram-695 014, Kerala, India Full list of author information is available at the end of the article © 2011 Nair et al; licensee BioMed Central Ltd This is an Open Access

Ngày tải lên: 11/08/2014, 08:20

... TGTAAAG TGTAAAG + ) + )95 )1100 )1470 ACACacG ACACttG ACACaaG + + + + ) ) ) ) ) )140 )1100 )1596 )1632 )140 )1100 )1596 )1632 )1874 CAaaTG CAagTG CAaaTG CAaaTG CAaaTG CActTG CAttTG CAgtTG TGAGTCA ... peptide was constructed as follows The DNA fragment was amplified from GmPDIM cDNA by PCR using the primers 5¢-GACGACGACAAGATGC ACGCACTCTATGGAGC-3¢ and 5¢-GAGGAGAAGC CCGGTTCATAGCTCATCCTTGCTTGAAG-3¢ ... soybean cotyledons during maturation (A) GmPDIM mRNA was quantified by real time RT-PCR Each value was standardized by dividing the value by that for actin mRNA Values are calculated as a percentage...

Ngày tải lên: 30/03/2014, 04:20

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... reduces to Darcy’s law, which is, however, based on the relative permeability for the gas phase (KP ) The relative permeability accounts for the reduction in pore space available for one phase due ... that incorporates the significant physical processes and the key parameters affecting fuel cell performance The model accounts for both gas and liquid phase in the same computational domain, and...

Ngày tải lên: 05/09/2013, 14:58

... And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31], α-glucuronidases that release ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... endo-glucanase, exo-glucanase and β-glucosidase Endo-and exo-glucanases are commonly referred to as “cellulases” Fungal strains of Trichoderma reesei are used to produce most commercial cellulase...

Ngày tải lên: 05/09/2013, 15:28

... focus on the reasons for gathering and analyzing data, as well as the formulation of this data into use cases Use cases will be the foundation for determining data requirements for the system ... skills and experience necessary to perform a task • Collect artifacts, such as printed documentation and manuals 50 Module 3: Using a Conceptual Design for Data Requirements Analyzing Information ... know to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement...

Ngày tải lên: 10/12/2013, 17:15

... have ready access to iodized salt because it was only distributed in urban areas, where demand was higher Free-market incentives for manufacturers to market iodized as well as regular table salt ... behavior management The current focus leads managers to biases that are based on their backgrounds and the singular choice of edu cation, marketing, or force of law as a paradigm of choice Each ... populations as to appropriate behavior The predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing...

Ngày tải lên: 18/02/2014, 02:20