... (section 1.1) of this chapter gives an overview of the application of in silico methods for pharmacokinetics and toxicity prediction The motivation for this work and an outline of the structure of ... million, with the preclinical phase and clinical phase costing US$335 million and US$467 million respectively (DiMasi et al 2003) Traditionally, pharmacokinetic and toxicological properties of ... fraction of drug bound in plasma; CART – classification regression tree; PCR – principal component regression; SIBAR – similarity based structure activity relationship; CIMI – chemically intuitive...
Ngày tải lên: 15/09/2015, 17:10
... Engineering of Towns and Industrial areas (CEETIA), Hanoi University of Civil Engineering and the help in gas composition analysis of Mr Thai Ha Vinh, from Monitoring and Environmental Analysis ... n.a Inhibiting and toxic substances During anaerobic degradation, a variety of substances in high enough concentrations have inhibitory effects The inhibitors can be distinguished according to ... to their origin such as inhibitors in the degradation by addition of substrate or inhibitors as intermediates Inhibitors which are introduced by adding substrate, include substances which were...
Ngày tải lên: 09/01/2015, 08:53
The chart below shows the amount of leisure time enjoyed by men and women of different employment status
Ngày tải lên: 04/10/2012, 10:02
Báo cáo y học: "Revision of late periprosthetic infections of total hip endoprostheses: pros and cons of different concepts"
... Int J Med Sci 2009, previously obtained aspirated fluid or biopsied material and the determination of their antibiotic susceptibility so that an organism-specific mixture of antibiotics can ... more difficult because of scarring, tissue shrinkage and osteoporosis caused by inactivity [37,40,41] In addition, abrasion of zirconium dioxide particles is to be expected during mobilization and ... Orthopaedics of the Orthopaedic Clinic Markgroeningen in Germany He is specialized in joint replacement with minimal-invasive techniques and foot surgery His special interest lies in the revision...
Ngày tải lên: 26/10/2012, 09:53
Consumer acceptance of cheese,influence of different testing conditions
... significant effect on hedonic liking for a selection of semi-hard and hard cheeses (shown in Tables 3, and Figs 2–4) In the following we will discuss similarities and differences between our findings ... The similarities and differences between the experimental conditions are shown in Table Laboratory evaluations took place in individual booths and social interaction was discouraged The serving ... for a selection of semi-hard and hard cheeses in this study Lack of a natural meal context during testing, similar expectations in the three testing situations and high familiarity of the product...
Ngày tải lên: 03/04/2013, 21:07
Evaluation of different weather files on energy analysis of buildings
... 246,375 Insulation category II III 0.72 /I – 0.28/III I 0.75 /I – 0.25/III 0.92 /I – 0.08/III 0.57 /I – 0.34/II – 0.09/III 0.61 /I – 0.29/II – 0.10/III I I I 0.80 /I – 0.20/II 0.86 /I – 0.14/III I 0.87 /I ... Panel He is also elected as a Junior Member of the International Institute of Refrigeration (IIR), and he is participating in many technical societies and scientific institutes in Greece E-mail address: ... Sarafidis Y., Lalas D.P European residential buildings and empirical assessment of the Hellenic building stick, energy consumption, emissions and potential energy savings Building and Environment...
Ngày tải lên: 05/09/2013, 15:28
Tài liệu Báo cáo khoa học: Identification of different isoforms of eEF1A in the nuclear fraction of human T-lymphoblastic cancer cell line specifically binding to aptameric cytotoxic GT oligomers ppt
... much more basic nature of the fastermigrating isoform of eEF1A in cancer cells, the estimation of its pI remains merely indicative A magnified image of this analysis, performed with a different nuclear ... displays specificity in recognizing GT oligomers, and the selective cytotoxic action on CCRF-CEM cells suggests a possible role for eEF1A in maintaining the viability and proliferative activity ... basic pH This result could hypothetically explain the higher affinity of the protein towards oligonucleotides simply on the basis of a charge increase at specific amino acids in its nucleotidebinding...
Ngày tải lên: 21/02/2014, 00:20
Improvement of different vaccine delivery systems for cancer therapy pptx
... there are limitations associated with the use of live viruses or bacteria including their limited DNA carrying capacity, toxicity, immunogenicity, the possibility of random integration of the vector ... challenges in enhancing sensitivity, maximizing specificity and minimizing toxicity of QDs, which must be undertaken before clinical applications can proceed [115] Conclusion The major aim in gene ... used in phase II clinical trial in patients with CIN 2/3 lesions [18] The administration of DNA in a dry-powder formulation of microscopic particles into the skin by a needlefree mechanism is an...
Ngày tải lên: 06/03/2014, 02:21
EVALUATION OF DIFFERENT TYPES OF CHEST SYMPTOMS FOR DIAGNOSING PULMONARY TUBERCULOSIS CASES IN COMMUNITY SURVEYS pot
... alone was considered for analysis and interpretation The institutional ethics committee of the TRC approved Table 1: Distribution of symptomatics and number of cases identified in three surveys ... sensitivity of symptom inquiry was 65% (179/ 277) and that of CXR was 80% (222/277) showing that yield of cases was similar in all the surveys Symptom inquiry is relatively simple and inexpensive ... Gothi et al and Baily et al11 The contribution of fever alone (without cough and chest pain) in identifying Indian Journal of Tuberculosis symptomatics and cases was negligible as observed in...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: Role of different moieties from the lipooligosaccharide molecule in biological activities of the Moraxella catarrhalis outer membrane pot
... OS chain moiety of the M catarrhalis LOS is important in biological activities such as serum resistance and adherence of epithelial cells, the linker moiety is critical for maintenance of outer ... Apicella MA & Smith AL (2002) Acylation of the lipooligosaccharide of Haemophilus influenzae and colonization: an htrB mutation diminishes the colonization of human airway epithelial cells Infect ... human epithelial cells in vitro and in vivo, while showing hypersensitivity to hydrophobic compounds, indicating that LOS contributes to most biological activities of the M catarrhalis outer membrane...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Neuropeptide Y, B-type natriuretic peptide, substance P and peptide YY are novel substrates of fibroblast activation protein-a pdf
... characterized Identifying substrates is a crucial step in gaining insights into the precise functions of proteases and their mechanisms of action in biology and disease DPP4 is the prototype member of ... Schmidt WE (1993) Dipeptidyl-peptidase IV hydrolyses gastric inhibitory polypeptide, glucagon-like peptide-1(7–36)amide, peptide histidine methionine and is responsible for their degradation in ... Neuronal nitric oxide synthase immunoreactivity in the guinea-pig liver: distribution and colocalization with neuropeptide Y and calcitonin gene-related peptide Liver 21, 374–379 1332 55 Ding WG, Kitasato...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: The role of cytochrome P450 monooxygenases in microbial fatty acid metabolism pdf
... other hand, alkanes serve as nutritional input during the initial colonization steps Insect cuticle consists of protein and chitin, and is covered by a highly resistant lipid layer: the epicuticle ... Interestingly, bacterial sphingolipid synthesis predominantly occurs in anaerobic species One such anaerobe is Sphingomonas paucimobilis Its sphingolipids are rich in a-hydroxymyristic acid and ... a-hydroxylation and sphingolipids, some questions remain: what is the biological role of P450Bsb in the non-sphingolipid-producing B subtillis and why is a mixture of a- and b-forms produced? It was...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: "Are These Documents Written from Different Perspectives? A Test of Different Perspectives Based On Statistical Distribution Divergence" ppt
... Dirichlet(θ|α + yi ∈A The posterior distribution p(θ|·) is a Dirichlet distribution since a Dirichlet distribution is a conjugate prior for a Multinomial distribution How should we measure the difference ... Vasileios Hatzivassiloglou 2003 Towards answering opinion questions: Separating facts from opinions and identifying the polarity of opinion sentences In Proceedings of the Conference on Empirical ... Pang and Lillian Lee 2004 A sentimental education: Sentiment analysis using subjectivity summarization based on minimum cuts In Proceedings of the Association for Computational Linguistics (ACL-2004)...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo Y học: Interaction of plasminogen activator inhibitor type-1 (PAI-1) with vitronectin Characterization of different PAI-1 mutants pdf
... metastable PAI-1 among serpins Puri®cation and inhibitory activity of recombinant PAI-1, PAI-2, and PAI-1 variants Interaction of (mutant) PAI-1 with Vn Recombinant expression in a bacterial system is ... dextran matrix of the CM5 chip, and then still was able to form complexes with uPA Inhibition of thrombin by PAI-1 and binding to Hep Binding to Vn provides wild-type PAI-1 with thrombin inhibitory ... The obtained speci®c activities of wild-type PAI-1 and wild-type PAI-2, respectively, strongly indicate that this modi®cation does not have any signi®cant effect on the inhibitory activity of the...
Ngày tải lên: 31/03/2014, 15:20
shape-controllable synthesis of ultrafine zno powders of different
... morphologies of ZnO powders The influence of the reaction time on the morphologies of ZnO powders was also discussed, as shown in Fig Fig 3(a) and (b) Fig SEM images of ZnO particles synthesized at: ... polarity, and the polarity of the solution was enhanced when the OHÀ/ Zn2þ mol ratio increased It was evident that the ZnO particles grew with self-organizing 3.3 Influence of the reaction time ... particles was significant The morphologies of ZnO particles transited from flake to flower-like to micro-rods with increasing the OHÀ/Zn2þ mol ratio This is because the NaOH solution was alkaline with strong...
Ngày tải lên: 06/05/2014, 13:26
Báo cáo sinh học: " Comparisons of the M1 genome segments and encoded µ2 proteins of different reovirus isolates" pptx
... I I I I I I I AI R I M S I I I R I V I Y S MR M H T I SS G S S S C R R V L S S V N S C Alignment of the deduced µ2 amino acid sequences of T1L, T2J, T3D, and various field isolates Figure Alignment ... packaging into progeny particles The particle locations and functions of most of the reovirus proteins have been determined by a combination of genetic, biochemical, and biophysical techniques ... regions of µ2 provide supportive evidence that this protein is involved in nucleotide binding and metabolism However, the described similarities did not match with greater than 90% certainty and...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Susceptibility of different leukocyte cell types to Vaccinia virus infection" potx
... (AATATAAATGGCTAGCAAAGGAGAAGAA) and GFPH3 (TTTAAAGCTTTACTAGTGGATCCTCAG), that include NheI and HindIII restriction sites, respectively After digestion with NheI and HindIII, the gene was inserted into the corresponding sites ... differences in infection to differential virus binding, internalization or gene expression in different PBL cell lineages In any event, the consequences of virus tropism in the pathogenicity of poxviruses ... understanding virus pathogenicity and immunogenicity Methods Cells, plasmids and virus Vaccinia virus strain WR was grown and titrated in BSC-1 or CV-1 cells, grown in minimal essential medium (EMEM)...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Effect of different cuff widths on the motor nerve conduction of the median nerve: an experimental study" doc
... decrease was evident, statistically this was not significant when the two tourniquets were compared [Fig 1] The difference became statistically significant only after 10 minutes of inflation of the cuffs ... generalize the findings of the present study, further studies can be carried with more number of different cuff widths and also with the tourniquet inflation time and occlusion pressure simulating ... ± 10.15 of its baseline value after 10 minutes of inflation whereas with the cm cuff the MNCV was 93.97% ± 16.10 of its baseline value After 15 minutes of inflation also a significant difference...
Ngày tải lên: 20/06/2014, 01:20