please don apos t stop talking about it

Biopython tutorial and cookbook

Biopython tutorial and cookbook

... gene and ITS1 and ITS2 DNA CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGGAATAAACGATCGAGTG AATCCGGAGGACCGGTGTACTCAGCTCACCGGGGGCATTGCTCCCGTGGTGACCCTGATTTGTTGTTGGG It contains 94 records, ... Seq(’CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGATGAGACCGTGG CGC’, IUPACAmbiguousDNA()) 740 Z78439.1 Seq(’CATTGTTGAGATCACATAATAATTGATCGAGTTAATCTGGAGGATCTGTTTACT GCC’, IUPACAmbiguousDNA()) 592 This time ... import Seq >>> from Bio.Alphabet import generic_dna >>> gene = Seq("GTGAAAAAGATGCAATCTATCGTACTCGCACTTTCCCTGGTTCTGGTCGCTCCCATGGCA" "GCACAGGCTGCGGAAATTACGTTAGTCCCGTCAGTAAAATTACAGATAGGCGATCGTGAT"...

Ngày tải lên: 22/10/2014, 21:00

324 1,5K 0
Tài liệu TOEFL iBT Scores: Better information about the ability to communicate... pptx

Tài liệu TOEFL iBT Scores: Better information about the ability to communicate... pptx

... requirements and admission criteria, contact the institution directly or view its Web site Institutions that have set their scores include: • Auburn University • Purdue University • Austin Community ... and the scores from the computer-based (CBT) and paper-based (PBT) versions of the TOEFL test Institutions may choose to set TOEFL iBT scores that are comparable to the CBT and PBT for the total ... 560 TOEFL PBT Listening 31 – 68 46 56 TOEFL PBT Reading 31 – 67 46 56 TOEFL PBT Structure 31 – 68 45 56 ETS Test and Test Section TOEFL PBT Total TOEFL CBT Total – 300 137 220 TOEFL CBT Listening...

Ngày tải lên: 10/12/2013, 05:15

20 481 1
Báo cáo y học: "The website contains a wealth of information regarding the management of trauma victims, as well as news about upcoming conferences and event" potx

Báo cáo y học: "The website contains a wealth of information regarding the management of trauma victims, as well as news about upcoming conferences and event" potx

... presented Medical students and residents are likely to gain the most benefit from working through the cases on this website, which is free ACLS.net — http://www.ACLS.net This free website contains ... appreciated by a diverse group of medical users I would highly recommend a visit to this site to anyone with an interest in trauma care Best feature Interactive nature of the clinical scenarios Worst ... Worst feature Several of the vignettes contain unnecessary text that becomes a nuisance to skim through Wish list More scenarios in the format of the ‘trauma team leader decision scenarios’ Other...

Ngày tải lên: 12/08/2014, 19:22

2 251 0
Write a report for a university lecturer describing the information in the graphs below

Write a report for a university lecturer describing the information in the graphs below

... answer: The graphs compare the number of deaths caused by six diseases in Someland in 1990 with the amount of research funding allocated to each of those diseases It can be clearly seen that the ... seen that the amount of research funding in many cases did not correlate with the seriousness of the disease in terms of numbers of deaths In 1990 there were around 0.2 million deaths from AIDS, ... deaths from leprosy, 0.3 million deaths from tropical diseases, 0.5 million deaths from diarrhoea, 0.4 million deaths from malaria and 1.8 million deaths from TB These figures can be contrasted...

Ngày tải lên: 04/10/2012, 10:02

2 1,6K 0
Write a report for a university lecturer describing the information in the two graphs below

Write a report for a university lecturer describing the information in the two graphs below

... to postgraduate studies At the other end of the scale we can see that by 1995 all girls were completing lower secondary, although 10% ended their schooling at this point This is in stark contrast ... contrast with 1945 when only 30% of girls completed primary school, 35% had no schooling at all and 35% only completed the third grade In conclusion, we can see that in the 50 years from 1945 to ... studies This situation had changed radically by 1995 In 1995, 90% of women in Someland had completed secondary education and of those, half had graduated from an initial degree and...

Ngày tải lên: 04/10/2012, 10:02

2 1,6K 2
101 ielts speaking part two tasks about the past present and future

101 ielts speaking part two tasks about the past present and future

... long they have had that job - What things they like about their job - What things they dislike about their job And say if you think that job suits that person or not, and why Describe one thing that ... first got that goal or ambition - What you need to to make it come true - What your next step needs to be And say if you think you will achieve that goal or ambition or not, and why Talk about ... particularly interesting - Where and how it is possible to study that subject And say if you think you will start studying that in the near future or not, and why Talk about a goal or ambition...

Ngày tải lên: 04/10/2012, 11:45

24 1,8K 9
Unit 9 - D. Writing - information about Sahara

Unit 9 - D. Writing - information about Sahara

... - Hµ Thu Hoµ - Chieng Sinh Upper Secondary School Today, some desert people still trade by camel across the desert Others have replaced their camels with trucks In oases, farmers grow date palms, ... palms, wheat, barley, and vegetables Life in the Desert: Not many plants and animals can survive the brutal heat and dryness of the Sahara Thorny shrubs and hardy grass, shown here, are often the only ... and dryness of the Sahara Thorny shrubs and hardy grass, shown here, are often the only plants that will grow ...

Ngày tải lên: 13/06/2013, 01:25

2 669 0
CCNA - V2 P2 - Getting Information About Remote Devices

CCNA - V2 P2 - Getting Information About Remote Devices

... about remote devices that aren t accessible by CDP • Once connected to a remote device, you may want to access your local device without terminating the Telnet session Telnet allows you to temporarily ... Router# • Tests the connectivity and path to a remote device © 2002, Cisco Systems, Inc All rights reserved ICND v2.0—2-8 Summary • The Telnet application is useful for obtaining information about ... to: • Use Telnet to connect to remote network devices, given operational access layer switches and routers • Use IOS commands to manage the Telnet sessions, given operational access layer switches...

Ngày tải lên: 08/07/2013, 01:27

10 379 0
All you need to know about the music business 7th edition

All you need to know about the music business 7th edition

... (without a written deal), and ironically they are often the ones who keep their clients the longest Even with these folks, I often a letter outlining the terms It spells out the percentages, states ... (or more than) they need the artist Please don t misunderstand this point Many legitimate and well-respected managers require written contracts, and there is nothing wrong with this But there are ... loyalty means you discuss it with them and tell them what needs to be changed (Again, if you don t want to it directly, it through another team member.) If things still aren t being done right,...

Ngày tải lên: 14/10/2013, 14:51

286 684 0
Information Security: The Big Picture – Part I

Information Security: The Big Picture – Part I

... information they are told and not question its validity The only protection is to try to ensure the authenticity of the person you are talking with Don t be afraid to have people authenticate themselves ... site can cause that trust to be lost Your organization’s reputation is based partly on the fact that it is perceived to be well run, treats business partners with respect, and that it takes the ... have little training in the subtleties of computer security Thus it is sometimes better, if you can, to use a combination of quantitative and qualitative techniques to give a more rounded picture...

Ngày tải lên: 18/10/2013, 18:15

27 602 1
Information Security: The Big Picture – Part II

Information Security: The Big Picture – Part II

... Security Evaluation Criteria, or ITSEC The ITSEC combined the Orange Book criteria with several of its European counterparts In addition, it covered the integrity and availability issues that the ... the picture need to communicate The call goes to the Central Office and the switch at the CO creates a circuit (here labeled Circuit 1) between the two phones The circuit stays active until the ... communicate The first computer breaks the transmission up into packets The first packet travels through Switch 1, the second travels through Switch and the third packet travels through Switch Once they...

Ngày tải lên: 22/10/2013, 16:15

33 538 1
Information Security: The Big Picture – Part III

Information Security: The Big Picture – Part III

... points that are communicating Each packet that travels through the Internet is treated as an independent unit of data without any relation to any other unit of data (The reason the packets get ... communicate with each other The Transport Layer actually interacts with your information and prepares it to be transmitted across the network It is this layer that ensures reliable connectivity from ... all the information that the Transport Layer on the other side of the connection needs to determine what to with the packet Once the transport header is put on the packet it is given to the Internet...

Ngày tải lên: 22/10/2013, 16:15

26 558 0
Executing Commands that Modify Information in the Database

Executing Commands that Modify Information in the Database

... of the Command object to the CREATE TABLE statement The following example sets the CommandText property of mySqlCommand to a CREATE TABLE statement that creates a table named MyPersons to store ... UPDATE, and DELETE statements, you can also use the ExecuteNonQuery() method to execute DDL statements such as CREATE TABLE Let's take a look at an example that executes a CREATE TABLE statement, ... removed by the DELETE statement Listing 8.7 illustrates the use of the ExecuteNonQuery() method to execute the INSERT, UPDATE, and DELETE statements shown in this section This program features a...

Ngày tải lên: 24/10/2013, 08:15

8 295 0
About the Contributors

About the Contributors

... 166 About the Contributors speaks regularly on the topics of customer-driven strategies and corporate brand strategies and is a trustee of the Marketing Science Institute At the time this article ... president and Global Head of the Digital Strategy group at Digitas, where his responsibilities include partnering with clients to determine how to use the Internet and emerging technologies to create ... Starbucks, 3–4 Statistical Analysis System (SAS Institute), 148 Statistics for Experimenters (Box, Hunter, and Hunter), 148 “stealth marketing,” 56 stimulus-response network, 146 strategic advantage, and...

Ngày tải lên: 24/10/2013, 08:20

18 469 0
w