plasticity in dna structure

... contain proline stretches; this factor has been implicated in multiple functions, including cell survival, differentiation and proliferation14–19 We confirmed the DNA demethylation of eIF5A1 in hindlimb ... representing a possible explanation for the reduction in the number of AChRs in the TA in SCT rats 14 dpo (Fig. 1D) The low levels of these four mature subunits in the TA cannot be maintained in the ... miR-211-5p binding sites located within the eIF5A1 3′ UTR (wild type) were responsible for the miRNA-mediated inhibition of reporter gene expression Accordingly, point mutations were introduced into

Ngày tải lên: 04/12/2022, 15:38

... after harvesting By initially decreasing over-storey density and basal area, canopy openings created by logging triggered a rapid increase in recruitment into the seedling and sapling layers The fact ... associations of Pinus ko-raiensis and Tilia amurensis in broad-leaved Korean pine mixed forest in Changbai Mountain Chinese Journal of Applied Ecology, 18: 1681–1687 (In Chinese) Corresponding author: ... Jilin Forest Industry Group, Changchun, China ABSTRACT: Broadleaved-Korean pine (Pinus koraiensis) mixed forest is a typical vegetation type in the eastern Eurasian continent We compared the structure,

Ngày tải lên: 07/08/2014, 03:22

... drawings on transparent sheets were scanned and analysed using WinRhizo [8] Competition aboveground by pine was assessed using the relative irradiance and a competition index As Pinus-dominated ... what extent leaves and fine roots may increase their physiolog-ical efficiency to maintain a balanced carbon-nutrient uptake within beech saplings would provide an interesting comple-ment to this ... shown) indicated that herbaceous fine-root biomass increased exponentially with light in the dense pine stands (R2 adj = 0.63), and was about 13-fold higher in the submature stand (ML + V) than in

Ngày tải lên: 08/08/2014, 00:21

... recorded from individual cells We previouslyhypothesized that this ongoing spontaneous bursting activity may interfere with inducing plasticity and main-taining changes [29] Therefore, in addition ... elimination of syn-apses, or they can take the form of strengthening or weak-ening of existing synapses (e.g [14-16]) In culture, plasticity in individual synapses can be induced by forcing the ... for plasticity induced by electrical stimulation in three series of investigations: Changes induced in burst patterns, Changes in stimulus-response maps, and Changes in specific responses Within

Ngày tải lên: 11/08/2014, 08:20

... the domains of Vif that are involved in binding to A3G and A3F [12-17] Furthermore, as a proof of principle, work by Mehle et al has shown that Vif peptides overlapping the A3G-binding domain were ... 3) Determine RT activity at each time point Determine RT activity at each time point Determine RT activity at each time point Infect with 1000 RT units from peak time point Determine infectivity ... time point Infect with equal infectious units Determine infectivity on TZM-bl cells from peak time point Analyze DNA Analyze DNA, cRNA, vRNA Analyze DNA, cRNA, vRNA A A3G A3F a-tubulin Trang

Ngày tải lên: 13/08/2014, 05:21

... DNA duplexes from which parameters describing dinucleotide flexibility can be obtained Trajectories are stable with the DNA maintaining a B-type conformation with standard hydrogen bond pairings ... matrix in helicoidal space (for a given base step pair) obtained from the MD samplings Datasets ProStar was trained using 5' ends of protein coding genes annotated by the Havana group [39] in the ... overlapping any Havana coding and non-coding genes (without a CpG island in the upstream region) were selected Standard Egasp rules were used also for these challenging sets Training We trained

Ngày tải lên: 14/08/2014, 08:20

... GATCCCTCGAGTCAAGCGGAAGCTGG containing rec-ognition sites of HindIII and XhoI restriction endonucle-ases The amplified DNA was cleaved with HindIII/XhoI and inserted into pcDNA3 (Invitrogen, USA) cleaved with HindIII/XhoI ... immune response in DNA immunization: advantages of the heterologous DNA prime, protein boost immunization regimen Ekaterina Alekseeva*1, Irina Sominskaya1, Dace Skrastina1, Irina Egorova2,3, ... levels of intracellular core expression, and that such a response can be improved by using low-expressing core genes, or single core gene primes in combination with recombinant core protein boosts

Ngày tải lên: 14/08/2014, 19:22

... Within cortical inhibitory circuits, one possible candidate for experience-dependent plasticity is the parvalbumin-expressing (PV) interneuron About 36% of Gad67-expressing interneurons in the ... calcium-binding protein PV (Lee et al., 2010), making PV interneurons the largest group of cortical interneurons Chandelier cells and about 50% of basket cells (mainly fast-spiking) in the somatosensory ... make PV interneurons prime targets for exhibiting experience-dependent plasticity during development There is evidence that PV interneurons are involved in experience-dependent plasticity in both

Ngày tải lên: 09/09/2015, 08:17

... target DNAs; Trang 272 Generating a hybridization solution containing a mixture of fluorescently labeledcDNAs;3 Incubating the hybridization mixture containing fluorescently labeled cDNAs withDNA ... is a long chain of DNA as defined two-in biology dictionary Durtwo-ing the second step, translation, cellular machtwo-inery builds aprotein using the RNA information as a blueprint Although there ... cDNAs withDNA chip; 4 Detecting bound cDNA using laser technology and storing data in a computer; 5 Analyzing data using computational methods We are obviously interested in 5, but without some knowledge

Ngày tải lên: 11/09/2015, 16:03

... shown to induce a preferential increase in insulin biosynthesis over other proteins14, 21, 22 Hence glucose must have a role in regulating insulin Trang 26The insulin gene promoter contains three ... paralleling its insulin release profile (See section 3.5.2 Glucose-induced quinacrine secretion in -TC-6.) As such, staining the cells with quinacrine would allow us to probe the intracellular insulin ... signaling cascade that results in insulin secretion into the tissue fluid and, more importantly, the islet vasculature through which it reaches the target cells2-4 Binding of insulin to the insulin

Ngày tải lên: 14/09/2015, 08:42

... 1 IntroductionFSI can be either oscillatory or non-oscillatory In the oscillatory interaction,the strain induced in the sold structure causes it to move in such a way thatthe source of strain ... outline of the thesis is as follows: In Chapter 2, we first introduce linear elastodynamics equation for the structure domain and incompressible Navier-Stokes equation for the fluid domain Since ... phenomenon with applications in many fields ofengineering as well as in applied sciences Furthermore, it is a crucial considerationin the design of many engineering systems[33] In recent years, it has

Ngày tải lên: 29/09/2015, 13:01

... guidance in conducting computer simulations; Mr Lin Honghuang for helping me generateDNA sequences and compute word counts when conducting the simulations; and ii Trang 3Mr Dong Bin, for giving me ... ), where Iu (i) is the indicator of the word u occurring at the starting position A i To determine whether a DNA word u is rare or abundant in a DNA sequence, one needs to introduce a probability ... the z score defined above in equation (1.1), and analyze the over- and under- representation of a finite set of DNA words as the sequence length goes to infinity, by investigating the behavior

Ngày tải lên: 30/09/2015, 14:23

... by RNA polymerase In Figure A, the repressor protein (R) binds to the regular binding site and blocks transcription In Figure B, the repressor protein can not bind to the binding site due to some ... de-noted as stringlet A k-stringlet is defined in terms of its k positions in a string and their content For example, the string AT GT AT contains the 3-stringlet −T − −AT The stringlet which ... constraint rules Intuitively,constraint mechanism is a general mechanism that is able to convert anyset of strings into corresponding patterns In contrast, each constraintrule is a refined constraint

Ngày tải lên: 03/10/2015, 21:58

... FIGURE 2.1 DNA replication licensing control by Geminin and CDKs during the cell cycle 42 FIGURE 2.2 Geminin Binding Domain of Human Cdt1 and Cdt1 Binding Domain of Human Geminin 44 FIGURE ... central role in controlling the timing of chromatin licensing Chromatin binding of both Cdc6/18 and Cdt1 depends on the presence of ORC on origin DNA, but these two factors bind independently ... Protein crystallization 61 Chapter3 Results 62 -3.1 Cloning and sequencing of the Geminin Binding Domain of hCdt1 62 -3.2 GBD-hCdt1 and RID-hGeminin were partly expressed as soluble protein

Ngày tải lên: 04/10/2015, 10:24

... helix-loop-helix BiP Binding protein BSA Bovine serum albumin CCKN2B Cyclin-dependent kinase inhibitor 2B CK19 Cytokeratin-19 CLD Cytoplasmic lipid droplets DAPI 4’,6-diamidino- 2-phenylindole DMEM Dulbecco’s ... as well as invasion capacity During EMT, increased level of extracellular components including collagens and fibronectin is observed These proteins stimulate integrin signaling and induce the ... al., 1990) Serving these vital roles are reticuloplasmins such as PDIs, Binding Protein (BiP), calreticulin, and endoplasmin These proteins have overlapping tasks such as protein-folding assistants

Ngày tải lên: 13/10/2015, 15:55

... 27sufficient for the transportation of BRCA2 into the nucleus. This region also harbours many  protein  interacting  domains  such  as  the  FANCD2  interacting  region, oligobinding (OB) domain and a Rad51 binding domain.   Many  proteins  are  known  to  interact  with  BRCA2.  ... configuration  (Kanugula,  2003).  The C‐terminal domain contains the DNA binding site and the cysteine containing active site  that  binds  to  O6‐alkylguanine  and  acts  as  an  acceptor  of  the  ... DNA can be damaged by mutagens which can alter DNA bases and thus the coding sequence.  Both  intrinsic  and  extrinsic  mutagenic  agents  are  capable  of  causing distinctive DNA damage. The intrinsic mutagenic agents include cellular metabolites, oxidants 

Ngày tải lên: 16/10/2015, 15:35

... a closed DNA molecule Since in a closed duplex DNA Lk is invariant, any change in T w, which maycome about as a result of binding of DNA to proteins (such as histones) or intercalating molecules, ... Each cell contains enzymes topoisomerases that regulateDNA supercoiling by constantly adjusting the linking number Since thelinking number of a closed DNA molecule remains constant during any de-formation ... distribution of intercalating agentsthat minimizes elastic energy of DNA o-rings, (iv) collapsed configurations of DNA o-rings subject to local overtwisting, (v) minimum energy rations of intrinsically

Ngày tải lên: 11/06/2017, 20:28

... engineering processes The insertion of pillaringagents (organic, organometallic, or inorganic complexes) expands the interlayerspacing leading to a two-dimensional channel system with porous structurescomparable ... fuel contains a lot of hardly reduced sulfur-containing compoundsbecause they are in heavy fractions and have high boiling temperature Normally,the amount of sulfur-containing compounds in fuel ... + which is1-2 nm in size,and can replace sodium ions in inner layers of clay through ion exchange reaction toform an intermediate layer in spacing structure of Mont This pillaring method isnot

Ngày tải lên: 27/07/2017, 23:17

... a plasticity gate allowing incoming sensory inputs to modify the efficacy of the activated intracortical circuits. During the time between bursts the plasticity gate is closed and incoming inputs ... phantom limb pain. Interestingly, phantom pain was more prom- inent in patientsin whom the motor representations of face muscles were displaced medially, possibly reflecting an invasion of the ... transmitted, or utilized in any form by any electronic, mechanical, or other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information storage...

Ngày tải lên: 17/02/2014, 19:20

... HsRad51 to examine whether these loops are actually involved in DNA binding. Because aromatic residues are involved in the ssDNA binding by bacterial single stranded DNA- binding protein (SSB) and ... residue in the L1 loop is involved in the functional DNA binding during strand exchange. Tryptophan-scanning mutagenesis of the HsRad51-L1 loop To gain further information about DNA binding by the ... 3159 alanine. If the aromatic side chain is involved in the interaction with DNA, then its replacement with alanine, a short side chain amino acid residue, should affect the DNA binding of the protein....

Ngày tải lên: 19/02/2014, 06:20