pet ct fusion and target delineation

Báo cáo khoa học: "Incidental thyroid lesions detected by FDG-PET/CT: prevalence and risk of thyroid cancer" ppsx

Báo cáo khoa học: "Incidental thyroid lesions detected by FDG-PET/CT: prevalence and risk of thyroid cancer" ppsx

... sensitivity and specificity of FDG -PET/ CT were 60% and 91% The positive predictive value and negative predictive value of the FDG -PET/ CT was 75% and 83% Jeong HS et al [21] showed that the FDG -PET/ CT ... advantages of the FDG -PET/ CT over FDG -PET include anatomic localization of focal uptake and evaluation of CT characteristics of the thyroid lesions detected on the FDG -PET/ CT Choi et al [1] reported ... screening subjects and in patients with suspected and known cancer was similar The factors that were related with an increased risk of a malignancy were focal FDG uptake on the FDG -PET/ CT and a high...

Ngày tải lên: 09/08/2014, 04:21

7 308 0
Báo cáo khoa học: "SemiDecreased 3D observer variation with matched CT-MRI, for target delineation in Nasopharynx cancer" pdf

Báo cáo khoa học: "SemiDecreased 3D observer variation with matched CT-MRI, for target delineation in Nasopharynx cancer" pdf

... windows, etc.) With clearer delineation instructions, together with the forced use of sagittal reconstructions and simultaneous delineation on CT and MRI, target delineation variation in the ... on CT: the impact of 18FDG-hybrid PET fusion Int J Radiat Oncol Biol Phys 2001, 51:923-931 17 Mah K, Caldwell CB, Ung YC, et al: The impact of (18)FDG -PET on target and critical organs in CT- based ... number of corrections per delineation was 33 (i.e., 7.3 corrections per cm2) The root mean square of Table Volume comparison Target Volume CTV el CTV Delineation phase 2 103 91 25 20 Standard Deviation...

Ngày tải lên: 09/08/2014, 08:22

8 234 0
Báo cáo khoa học: "SemiFDG-PET/CT imaging for staging and target volume delineation in conformal radiotherapy of anal carcinoma" potx

Báo cáo khoa học: "SemiFDG-PET/CT imaging for staging and target volume delineation in conformal radiotherapy of anal carcinoma" potx

... Wilcoxon rank test showed PET- GTV and PET- CTV to be significantly smaller than CT- GTV (p = 1.2 × 10-4) and CT- CTV (p = 2.9 × 10-4) respectively PET/ CT- GTV and PET/ CT- CTV, that were used for clinical ... 3.7% GTV and CTV contours changed in 55.6% and 37.0% of cases respectively PET/ CT- GTV and PET/ CT- CTV, that were used for clinical purposes, were significantly greater than CTGTV and CT- CTV These ... gastro-intestinal tract tumors In particular, the GTV was drawn manually on CT and semi-automatically on PET images For delineating the PET/ CT- GTV and the PET/ CT- CTV, the operator considered both CT and PET information...

Ngày tải lên: 09/08/2014, 08:22

7 353 0
báo cáo khoa học: "The role of 18F-FDG-PET/CT in the preoperative staging and posttherapy follow up of gastriccancer:Comparison with spiral CT" docx

báo cáo khoa học: "The role of 18F-FDG-PET/CT in the preoperative staging and posttherapy follow up of gastriccancer:Comparison with spiral CT" docx

... results of the PET/ CT and CT studies showed completely concordant findings and no additional foci were detected by PET/ CT Of these 16 patients, 2/16 were in the first group, 12/16 in Group and 2/16 ... had compatible PET/ CT and CT results In the other half of these patients PET/ CT gave more accurate results than thoracoabdominal CT examinations In 1/2 of these patients, PET/ CT showed increased ... age:56,0 ± 15) and 42 PET/ CT reports were included in the study patients have undergone at least PET/ CT scans The concurrent thoracoabdominal CT results were compared with the PET/ CT results Also,...

Ngày tải lên: 09/08/2014, 02:20

5 393 0
báo cáo khoa học: "Concomitant pulmonary and thyroid tumors identified by FDG PET/CT and immunohistochemical techniques" ppt

báo cáo khoa học: "Concomitant pulmonary and thyroid tumors identified by FDG PET/CT and immunohistochemical techniques" ppt

... months FDG PET / CT was performed, and resection specimens of lung and thyroid were detected by hematoxylin eosin staining (HE) and IHC PET / CT: lung tumor SUVmax: 3.69, delay: 5.17; and thyroid ... effective therapeutic approaches can be designed and conducted Background Early detection and correct diagnosis are essential for definite treatment and better outcome of cancer patients FDG PET/ CT ... 19.97, low CT density and ambiguity of the border (Figure 1C) This patient was therefore hospitalized and subjected to a right lung mid lobe lobectomy and mediastinal lymph node dissection According...

Ngày tải lên: 09/08/2014, 02:21

17 295 0
Báo cáo khoa học: "PET-CT staging of the neck in cancers of the oropharynx: patterns of regional and retropharyngeal nodal metastasis" potx

Báo cáo khoa học: "PET-CT staging of the neck in cancers of the oropharynx: patterns of regional and retropharyngeal nodal metastasis" potx

... that PET- CT could accurately detect nodal disease in the staging of head and neck cancer patients Furthermore, several studies have already shown that adding PET- FDG or PET/ CT- FDG to standard ... size and/ or mean SUV criteria defined above were considered “positive” All scans were PET- CT fusion studies and were obtained on a single scanner at MBPCC in the majority of cases (47/53) PET- CT ... lymphadenopathy and RPLN status via pretreatment PET- CT imaging Materials and methods Institutional Review Board approval was obtained before initiating this retrospective chart review A hundred and one...

Ngày tải lên: 09/08/2014, 03:22

5 340 0
Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

Báo cáo khoa học: "F-FDG PET/CT-based gross tumor volume definition for radiotherapy in head and neck Cancer: a correlation study between suitable uptake value threshold and tumor parameters" pdf

... comparisons, image overlays, fusion of PET and CT images, and PET/ CT simulation Since there is less co-registration error between PET and CT using the same DICOM coordinates, PET/ CT simulation is a promising ... attenuation correction and iterative reconstruction algorithm Immediately after whole body PET/ CT images, patients were simulated in a RT set-up position on the PET/ CT scanner table with a head and neck ... acquire both the CT and PET data in total CT images were obtained at 120 kVp and variable mA (AutomA technique) with 3.75-mm slice The PET data were reconstructed by application of the CT- based attenuation...

Ngày tải lên: 09/08/2014, 09:20

8 369 0
Báo cáo khoa học: "[18F]fluoroethylcholine-PET/CT imaging for radiation treatment planning of recurrent and primary prostate cancer with dose escalation to PET/CT-positive lymph node" potx

Báo cáo khoa học: "[18F]fluoroethylcholine-PET/CT imaging for radiation treatment planning of recurrent and primary prostate cancer with dose escalation to PET/CT-positive lymph node" potx

... http://www.ro-journal.com/content/6/1/44 clinical target volumes [3,4] The potential roles of PET/ CT in radiooncology are (1) patient selection for treatment and (2) target volume selection and delineation, because PET/ CT with radiolabelled ... Survival FEC -PET/ CT The PET/ CT- studies were positive in 24/26 cases In primary cancer, one patient had bone metastases and bladder infiltration, and one had FEC-uptake in the prostate gland and pelvic ... received PET/ CT- planned IMRT to the prostate gland, seminal vesicles and pelvic lymph nodes of 45 Gy with a boost to the PET/ CT positive seminal vesicle and lymph nodes of 55.8 Gy at 1.8 Gy per fraction...

Ngày tải lên: 09/08/2014, 09:20

8 462 0
Báo cáo khoa học: "FDG-PET/CT imaging for staging and radiotherapy treatment planning of head and neck carcinoma" pps

Báo cáo khoa học: "FDG-PET/CT imaging for staging and radiotherapy treatment planning of head and neck carcinoma" pps

... CT; "PEToutCT" is the volume identified by PET but not by CT; "CToutPET" is the volume identified by CT but not by PET; "CT &PET" is the common volume of PET and CT Results Tumor staging PET/ CT ... Abbreviations: PET/ CT- GTV: the composite volume between PET and CT; PEToutCT: the volume identified by PET but not by CT; CToutPET: the volume identified by CT but not by PET; CT &PET: the common ... PET (PET- GTV), and PET/ CT images (PET/ CTGTV) The PET/ CT- GTV included both PET and CT information The clinical target volume (CTV), for treatment purpose, was identified as the PET/ CT- GTV with an...

Ngày tải lên: 09/08/2014, 09:22

6 574 0
Báo cáo khoa học: " Comparison of CT and integrated PET-CT based radiation therapy planning in patients with malignant pleural mesothelioma" pot

Báo cáo khoa học: " Comparison of CT and integrated PET-CT based radiation therapy planning in patients with malignant pleural mesothelioma" pot

... Figure CT, (d) coronal PET- CT Representative image of a patient with CT- and PET- CT based GTV delineations; (a) axial CT (b) axial PET- CT, (c) coronal Representative image of a patient with CT- and ... with CT- and PET- CT based GTV delineations; (a) axial CT (b) axial PETCT, (c) coronal CT, (d) coronal PET- CT *Abbreviations: GTV = gross tumor volume; CT = computed tomography; PETCT = positron ... by PET data In one patient, volumes were increased by PET- CT compared with CT; these increases were 19%, 2%, 10% and 15% in GTV, CTV, PTV1 and PTV2, respectively This Table 1: Patient characteristics...

Ngày tải lên: 09/08/2014, 10:20

7 364 0
Báo cáo khoa học: " Integrated-boost IMRT or 3-D-CRT using FET-PET based auto-contoured target volume delineation for " pps

Báo cáo khoa học: " Integrated-boost IMRT or 3-D-CRT using FET-PET based auto-contoured target volume delineation for " pps

... generated For delineation of CTV1, defined as biological target volume from postoperative FET -PET imaging, an auto-contouring process was used The definition of the biological target volume with PET is ... individually adapted to organs at risk and osseous structures The PTV2 was generated automatically by adding a 0.5 cm margin to the CTV2 and excluding CTV1 Target Gy % Volume max dose 77.04 - uniform ... parameter and also volume parameters and biological effects are taken into account Further plan comparisons are simplified The prognostic impact of this technique based on MR- and FET -PET imaging...

Ngày tải lên: 09/08/2014, 10:20

12 333 0
Báo cáo khoa học: " Comparison of T2 and FLAIR imaging for target delineation in high grade gliomas" pptx

Báo cáo khoa học: " Comparison of T2 and FLAIR imaging for target delineation in high grade gliomas" pptx

... anatomic landmarks on the CT and MRI 3D translations and rotations were then performed and visually verified in axial, sagittal and coronal views Each fusion was approved by the physicist and treating ... 0.0001 for CTV and p = 0.0001 for PTV) The average overlap (intersection) of the T2 and FLAIR CTVs was 83.84 cc and the average union was 126.34 cc The average intersection of the T2 and FLAIR ... is contoured in light green The T2 and FLAIR CTVs are outlined in red and cyan respectively The T2 and FLAIR PTVs are outlined in orange and dark blue respectively The FLAIR PTV encompasses a...

Ngày tải lên: 09/08/2014, 10:20

7 452 0
Báo cáo khoa học: " Correlating metabolic and anatomic responses of primary lung cancers to radiotherapy by combined F-18 FDG PET-CT imaging" ppsx

Báo cáo khoa học: " Correlating metabolic and anatomic responses of primary lung cancers to radiotherapy by combined F-18 FDG PET-CT imaging" ppsx

... performed by independent PET and CT readers PET and CT images were also merged (fusion analysis) for functional and anatomic correlation CT -PET images were displayed on AW/Xeleris and Medview workstations ... cancers and small cell cancers) treated with radiotherapy with pretreatment dedicated contrast CT, F-18 FDG PETCT and post-treatment PET- CT were included Baseline pre-radiotherapy PET- CT was performed ... reduc- Table 2: CT and local control status Table 3: PET and local control status N = 20 CT Response CT non-response Local control Local failure 12 N = 20 Local control PET Response 17 PET non-response...

Ngày tải lên: 09/08/2014, 10:21

6 308 0
Tài liệu Tìm hiểu cách thức về việc chụp PET/CT docx

Tài liệu Tìm hiểu cách thức về việc chụp PET/CT docx

... www.nhspetctdiagnosticimagingservice.com liên hệ với theo địa đây: Đường dây thông tin Bệnh Nhân: 0845 600 2953 Fax: 0845 600 2954 Email: infopetct@inhealthgroup.com Để biết thêm thông tin chụp PET/ CT, ... việc chụp kiểm tra lại vòng 48 kết gửi tới bác sỹ bạn , người giới thiệu bạn chụp PET/ CT Nhân viên phòng chụp PET/ CT đưa kết chụp cho bạn Thông tin quan trọng Liều 18FDG (gluco dạng phóng xạ) có ... quang kỹ thuật viên y tế hạt nhân giải thích quy trình chụp cho bạn Đừng ngại hỏi câu hỏi chụp PET/ CT vào thời điểm Một nhân viên X quang kỹ thuật viên y tế hạt nhân tìm hiểu chút bệnh sử bạn để...

Ngày tải lên: 16/01/2014, 22:20

4 668 5
Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

Tài liệu Báo cáo khoa học: Molecular characterization of Arabidopsis thaliana PUF proteins – binding specificity and target candidates doc

... APUM-2 and 5¢-CGATG CAGAAATTCAGTAGCAACATGGTGGAACGATGTC TCA-3¢ (forward) and 5¢-GCATGAGACATCGTTCCAC CATGTTGCTACTGAATTTCTGCA-3¢ (reverse) to APUM-7 Qualitative and quantitative b-galactosidade activity ... NRE(A+B)); and in both Box A and B, NRE(A–B–) (C) Qualitative analysis of LacZ reporter activation in the interaction of APUM-2 and APUM-7 with NRE WT and NRE mutants The iron responsive element RNA and ... human and mouse possess two; and Drosophila and Dyctiostelium have only one member [5] Recently, new studies have revealed the presence of ten, two and one homologs in Trypanosome, Plasmodium and...

Ngày tải lên: 18/02/2014, 06:20

15 587 0
Tài liệu Báo cáo khoa học: "Nonlinear Evidence Fusion and Propagation for Hyponymy Relation Mining" pdf

Tài liệu Báo cáo khoa học: "Nonlinear Evidence Fusion and Propagation for Hyponymy Relation Mining" pdf

... nonlinear evidence fusion and propagation significantly improve the precision and coverage of the extracted hyponymy data This is one of the technologies adopted in our semantic search and mining system ... model that we exploited is introduced in Section Our main approach is illustrated in Section Section shows our experimental settings and results Finally, Section concludes this paper Related Work ... as R), and their ratios The statistics are obtained by performing maximal likelihood estimation (MLE) upon our corpus and a random selection of term-label pairs from our term sets (see Section...

Ngày tải lên: 20/02/2014, 04:20

10 378 0
Báo cáo khoa học: "Learning to Translate with Source and Target Syntax" pot

Báo cáo khoa học: "Learning to Translate with Source and Target Syntax" pot

... (2004; 2006) and is similar to Stat-XFER (Lavie et al., 2008), we obtain the following grammar extraction method, which we call exact tree-to-tree extraction Given a pair of source- and target- language ... (4) and (5) cross, and therefore cannot both be constituents in the same tree In other words, exact tree-to-tree extraction commits to a single structural analysis but fuzzy tree-to-tree extraction ... bitexts, and one on two billion words of English These were smoothed using modified Kneser-Ney (Chen and Goodman, 1998) and stored using randomized data structures similar to those of Talbot and Brants...

Ngày tải lên: 07/03/2014, 22:20

10 378 0
Báo cáo khoa học: "Bridging Morpho-Syntactic Gap between Source and Target Sentences for English-Korean Statistical Machine Translation" pot

Báo cáo khoa học: "Bridging Morpho-Syntactic Gap between Source and Target Sentences for English-Korean Statistical Machine Translation" pot

... sentence, we can select as pseudo words a subjective particle and an objective particle , and insert them after the corresponding dependents Eugene and guitar respectively on content-words, ... training and decoding in EnglishKorean SMT In particular, we transform a source language sentence by inserting pseudo words and syntactically reordering it to form a target sentence structure in ... according to their respective null alignment probabilities Figure shows the top selected dependency relations (actually used in the experiment) and the aligned Korean function words (can ’t) ((play)...

Ngày tải lên: 17/03/2014, 02:20

4 298 0
Báo cáo khoa học: "Resolving Translation Ambiguity and Target Polysemy in Cross-Language Information Retrieval" potx

Báo cáo khoa học: "Resolving Translation Ambiguity and Target Polysemy in Cross-Language Information Retrieval" potx

... pairs, and the effects of human-computer interaction on resolving translation ambiguity and target polysemy will be studied in the future References Ballesteros, L and Croft, W.B (1996) "Dictionary-based ... Resolution Models In the recent works, Ballesteros and Croft (1998), and Bian and Chen (1998) employ dictionaries and co-occurrence statistics trained from target language documents to deal with translation ... CW2, , and C W m Assume the corresponding English translations of C, CW~, CW2, , and CWm are E, EW,, E W , , and EWm, respectively EWe, EW2, , and EWm form an augmented translation restriction...

Ngày tải lên: 17/03/2014, 07:20

8 293 1
w