... Instead, early childhood professionals draw on all these fundamental ideas (as well as many others) when making decisions about their practice An understanding of the nature of development and learning ... developmental goals The program has a systematic plan for collecting and using assessment information that is integrated with curriculum planning C The methods of assessment are appropriate to the age and ... statement of the National Association for the Education of Young Children Carnegie Task Force on Learning in the Primary Grades 1996 Years of promise: A comprehensive learning strategy for America’s...
Ngày tải lên: 07/03/2014, 17:20
... graduates who want to apply for an assistant professor position at your department These talks are really helpful to show you the competition among Ph.D graduates, and they may also give you an ... the first year Besides the professors, the TA’s of the courses you are taking in your first year are also an important part of the first year life Don’t hesitate to talk to them Go to their office ... have a competitive knowledge of calculus and linear algebra Familiarity with statistics is also welcome The ideal is to have knowledge of real analysis and some concepts of measure theory The...
Ngày tải lên: 08/03/2014, 05:20
Báo cáo nghiên cứu khoa học " ESTABLISHMENT OF THE GLOBALGAP SYSTEM FOR DRAGON FRUIT FAMERS AND EXPORTER IN THE SOUTHERN PROVINCES " pptx
... GlobalGAP standards with changes in content and form; Re-writing and upgrading the quality management system for packing house to become a manual for Dragon fruit quality management system manual ... Internal SGS – Vietnam training on HACCP and Internal Audit for SOFRI and provincial staff SOFRI’s staff and other facilitators from established model of GlobalGAP of 30 people had also trained ... presentation was then, used as tools in training for farmers and packers in this area 3.2 Development of quality manual The manual was first written by English and the translated into Vietnamese The...
Ngày tải lên: 22/06/2014, 12:20
báo cáo khoa học: " A Guide for applying a revised version of the PARIHS framework for implementation" pdf
... and a set of questions for diagnostic analysis and planning All of the separate components of the actual Guide are contained in additional files (see Additional Files 1, 2, and 4) The main narrative ... need for clear conceptual and operational definitions, measurement approaches, and additional practical information about the realities of application • QUERI frames of reference and concepts affected ... of information on performance Use of multiple methods: Clinical Performance Evaluations Economic - Facilitation Page of 10 Experience Task Doing for others Episodic contact Practical/technical...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt
... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors reviewed...
Ngày tải lên: 14/08/2014, 08:20
A Preliminary Evaluation of the English Course for Academic Purposes at the International Department, Thai Nguyen University = Đánh giá sơ bộ khóa học tiếng Anh
... options than course evaluation for providing the same sort of quantifiable and comparable data (Abrami, 2001) In general, most of researchers have appreciated the students‟ evaluation in being a useful ... idea of materials evaluation as follows: „…materials evaluation plays such an important role in language teaching that its potential for influencing the way teachers operate is considerable Materials ... evaluations generally assess different and separable aspects of an instructor‟s teaching behaviours and particular aspects of a course (Beran, Violato & Kline, 2007) According to Pamela Pamela...
Ngày tải lên: 28/03/2015, 08:55
Tài liệu Báo cáo khoa học: Control of the coagulation system by serpins Getting by with a little help from glycosaminoglycans pptx
... concentration of AT and the rates of interaction in the presence and absence of heparin pentasaccharide (Table 1), one can calculate that the half-life of enzyme activity in the absence of heparin ... such as thrombin, indicating that the conformational change in AT alone does not cause much acceleration in the rate of interaction [15] For full acceleration of the rate of inhibition of enzymes ... thrombin anion-binding exosite-1 is a primary part of the allosteric activation mechanism For many years, the physiological activator of HC-II has been assumed to be extravascular dermatan sulfate...
Ngày tải lên: 20/02/2014, 02:21
A SYSTEM OF LOGIC, RATIOCINATIVE AND INDUCTIVE, BEING A CONNECTED VIEW OF THE PRINCIPLES OF EVIDENCE, AND THE METHODS OF SCIENTIFIC INVESTIGATION pdf
... cut the matter short by saying, two ideas They would say, that the subject and predicate are both of them names of ideas; the idea of gold, for instance, and the idea of yellow; and that what takes ... independent of the reason A man may have been named John, because that was the name of his father; a town may have been named Dartmouth, because it is situated at the mouth of the Dart But it is no part ... thing as to be a son But when we call one man a father, another a son, what we mean to affirm is a set of facts, which are exactly the same in both cases To predicate of A that he is the father of...
Ngày tải lên: 06/03/2014, 13:20
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... Institute, Oakland, CA, USA for performing GC/MS analyses, and Professor Walter Miller, University of California, San Francisco for the gift of N-62 StAR protein and StAR protein antiserum The excellent ... was isolated at the Albany Medical College and stored at )80 °C The skin and internal organs were harvested from female C57BL/6 mice aged weeks at telogen and anagen stages of the hair cycle as...
Ngày tải lên: 23/03/2014, 13:20
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... sensitive traffic and that allow an active attacker remarkable leverage At the root of many of the most important practical vulnerabilities in P25 systems are a number of fundamentally weak cryptographic, ... 20ms of audio, for a total 180ms of encoded audio in each LDU frame), plus additional metadata and a small amount of piggybacked low speed data Each LDU, including headers, metadata, voice subframes, ... same channel allocations as existing legacy narrowband analog FM two-way radios To facilitate a gradual transition to the system, P25-compliant radios must be capable of demodulating legacy analog...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx
... 11783–11786 Hanasaki, K., Varki, A. , Stamenkovic, I & Bevilacqua, M.P (1994) Cytokine-induced beta-galactoside alpha-2,6-sialyltransferase in human endothelial cells mediates alpha-2,6-sialylation of adhesion ... (Molecular Dynamics, Sunnyvale, CA, USA) Chromosomal localization The human chromosomal map location of siglec-10 was determined using the Stanford G3 Radiation Hybrid Panel (Stanford University) A ... kinase assays indicate that the cytoplasmic domain of the siglec protein can be phosphorylated by representatives of at least three of four major families of kinases: Jak3, Lck, Emt but not ZAP-70...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... evidence of the stability of the syndesmosis may be obtained • The final test for stability of the calcaneofibular ligament is carried out by percussion of the examiner's fist against the heel of the ... differentiated testing of the functions of the cervical spine by the examining physician (additional file 1) One hand of the physician fixes the axis of rotation on top of the head, the other hand ... practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on the...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... (iv) the totalised values for area Atotal , Stotal , and time Ttotal ; the time based degree of parallelism γt the ranks of all vertices; the density ρ of the system graph These values can be achieved ... incorporates several constraints on the available silicon area (hardware capacity), B Knerr et al memory (software capacity), and latency as a timing constraint The global criticality/local phase ... values for ρ The metric κ has been calculated for all the sample graphs, and the performance of GA, TS, and RRES has been plotted against this characteristic value, as shown in Figure 11 The Ω values...
Ngày tải lên: 22/06/2014, 06:20
Báo cáo lâm nghiệp: "Status of an indigenous agro-forestry system in changing climate: A case study of the middle Himalayan region of Tehri Garhwal, India" potx
... especially Bagwati Bangwal, Shushila and Asha Ram, is greatly acknowledged References Dadhwal K.S., Narain P., Dhyani S.K (1989): Agroforestry systems in the Garhwal Himalayas of India Agroforestry ... urinary complaints herb Lens esculenta Moench Fabaceae Masur sd herb Mangifera indica L Anacardiaceae Aam sd, bk Carissa opeca Stapf Apocynaceae Karonda lf, rt, bk skin diseases diarrhoea, haemorrhage, ... produced about 10 kg Setaria italica per year It was matured 15–20 days before Echinochloa frumentacea and was one of the important crops of the Baranaja system of Garhwal The dishes prepared from...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo khoa học: " Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. I. Spatial variation" pot
... boundary was not always uniform at the cellular level, mainly because of the occurrence of parenchyma bands In this area, parenchyma cells changed from a radially flattened type to a radially dilated ... several dry seasons and the last one was just before the examination The lack of rainfall could thus have restricted plant growth seasonally For observations and measurements, trunks cut at the base, ... that induce the differentiation of wood (Aloni, 1989) Climatic variations could also have had repercussions on wood formation, especially the lack of rainfall, as in the wood of Carya glabra...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo khoa học: "Vegetative development, primary and secondary growth of the shoot system of young Terminalia superba tropical trees, in a natural environment. II. Terminal growth, lateral growth and main stem-branch growth correlations" ppsx
... mean diameter of axes was measured with a calliper rule: main stems at cm above and below each tier, and different branches at the base a tape A complete set of data was collected for each of the ... one after another Finally, apical dominance was re-established and the tree had a new main stem (stage 5) Radial growth of the ’decapitated’ plant similar to the other plants, except in the young ... shrinkage) The speed of radial growth was increased during March and after, in the equivalent parts of main stems Growth of a For an tree T "decapitated" plant unknown reason, the main apex of died...
Ngày tải lên: 08/08/2014, 23:22
Báo cáo y học: "Preliminary evidence for a change in spectral sensitivity of the circadian system at night" potx
... could mathematically represent both the pupil and iris A relative measurement, referred to as relative pupil area (rPA) was obtained by dividing the pupil area by the iris area Only the rPA values ... is at or near 480 nm Although a change in absolute sensitivity of the visual system over the course of the 24-hour day has been studied, there are no comparable studies for a change in the absolute ... analyses and interpretation MSR conceived the study, helped to collect the data, participated in the data analyses and interpretation, and helped to draft the manuscript All authors read and approved...
Ngày tải lên: 10/08/2014, 09:20