pathogens and recombinant dna

... Trang 1Recombinant DNA and allied methods 1. Cut long strings of DNA into fragments with restriction enzymes and separate them by gel electrophoresis 2. Isolate, amplify, and purify fragments ... facilitate recombinant DNA fabrication.  Cutting the vector and DNA fragments generates complimentary sticky ends that increase the efficiency of ligation between the vector and insert DNA Step ... 6Hybridization in DNA microarrayDNA microarray Gel electrophoresis and hybridization to map DNA fragments  Southern blot  Cut whole genomic DNA with restriction enzyme  Separate DNA fragments

Ngày tải lên: 20/06/2017, 07:56

... FTA as an effective technology for sampling and retrieval of DNA and RNA viruses from plant tissues and their subsequent molecular analysis Results: DNA and RNA viruses were successfully recovered ... Institute of Tropical Agriculture-Eastern and Southern Regional Center and Natural Resource Institute, Box 7878, Kampala, Uganda and 5 ARC-Roodeplaat Vegetable and Ornamental Plant Institute, Private ... practical, economical and sensitive method for sampling, storage and retrieval of viral pathogens and plant genomic sequences, when working under controlled conditions and in the field Application

Ngày tải lên: 19/06/2014, 08:20

... that uses the DNA as a template We observed that the NH2-functionalized polymer film was useful for aligning and immobilizing the DNA, and thus the DNA-templated nanowires Keywords: DNA molecules; ... phosphate groups in the DNA The observation by AFM showed that the DNAs stretched on the NH2-functionalized polymer films and that the AuNPs were assembled along DNA molecules Results and discussions ... aligned DNA molecules was 0.41 ± 0.17 nm (Figure 3b), and this value was consistent with the height of a double-stranded DNA from the AFM measurements that were reported by other groups [10, 11] λ-DNAs

Ngày tải lên: 20/06/2014, 23:20

... transformed.. .Recombinant enzyme technique (ReE) • Difinition: ReE are proteins which are produced by recombinant DNA technique • History of recombinant DNA tachnique: The recombinant DNA technique ... insulin DNA and plasmid DNA are mixed together with ligase enzyme the sticky end bases form hydrogen bonds the ligase joins the DNA backbone and a recomninant plasmid is produced -the recombinant ... fungi and plants Baby food Tripsin [...]... vector: plasmids from bacteria are cut with the same restriction enzyme to produce sticky ends • Formation of recombinant DNA: identification and

Ngày tải lên: 02/08/2014, 08:21

... design DNA-directed alkylating agents by linking the alkylating pharmacophore to the DNA-affinity molecules (e.g., DNA intercalating agents, DNA minor groove binder) [7,8] In most cases, the DNA-directed ... prior to irradiation and were stained at 24 and 48 h postirradiation (2 Gy) Both adherent and detached cells were collected, centri-fuged, and double stained with Annexin V-FITC and propidium iodide ... produce DNA interstrand and/or intrastrand cross-links [29,30] As has been known, bifunctional alkylating agents induce collapsed replication forks that can lead to either cell cycle arrest, DNA

Ngày tải lên: 09/08/2014, 09:20

... signals), and Pol II (black) signals from Affymetrix tiling arrays Promoter and terminator regions are taken as 400 bp up- and downstream of the start and stop codons, respectively, and divided ... com-plex and interconnected processes that involve opening of the local chromatin structure around the DNA region to be transcribed, binding and transcription by RNA polymerase II (Pol II), and processing ... the different chromatin-and transcription-related features across intron-less chromatin-and Figure 1 An example of FAIRE, Pol II ChIP-chip, and expression data The top and bottom panels with green

Ngày tải lên: 09/08/2014, 23:20

... proteins, and depositions of structural polymers such as calloseand lignin Acidic PR proteins, including acidic β-1,3-glucanases and chitinases, act Trang 19against fungal and bacterial pathogens ... Many agrochemicaland biotechnological companies throughout the world are increasing their interest andinvestment in the biological control of plant diseases and pests For plant pathogens alone,the ... Gliocladium and Trichoderma Species Systems The fungus Gliocladium virens Miller, Giddens and Foster (⫽Trichoderma virens, Miller, Giddens, Foster, and von Ark) is a common soil saprophyte and one

Ngày tải lên: 11/08/2014, 15:20

... article Identification and expression analysis of WRKY transcription factor genes in canola (Brassica napus L.) in response to fungal pathogens and hormone treatments and Nat NV Kav*1 Address: ... [11,23,35-38] and have been demonstrated to be involved in the defense against phytopathogens such as bacteria [25,39-42]; fungi [43-45]; and viruses [46,47] The responses of Arabidopsis to pathogens ... importance of WRKYs in responses to pathogens and hormone signaling, there are no reports as of yet, describing WRKY TFs in canola and their role(s) in mediating responses to pathogens In our previous

Ngày tải lên: 12/08/2014, 03:20

... HIV-1 X4 and R5 laboratory strains represented by HIV-1IIIb and HIV-1ada respectively Total DNA, collected and purified at days 3 and 7 post-infection, was analyzed by PCR, and both HIV-1IIIband HIV-1adaproviral ... DNA detection Cellular and proviral DNAs were extracted from sam-ples by DNAeasy kit (Qiagen, Hilden, Germany) Puri-fied DNA (0.5 μg) was amplified by PCR using SK431 and SK462 HIV-1 gag gene ... these strains are able to enter and integrate their retro-transcribed proviral DNA in the host cell genome Subsequent experiments indicated that HIV-1 strains and recombinant gp120 elicited a reliable

Ngày tải lên: 13/08/2014, 01:20

... (upper panel, lanes 1 and 2; 3 and 4; 9 and 10) and 5D) For KK240,4AE mutant, approximately 51% of viral DNA was nucleus-associated (Fig 5C (upper panel, lane 7 and 8) and 5D) Remarkably, in ... lysed and virus composition and trans-incorporation of RT and IN of each virus stock were analyzed by Western blot analysis with anti-IN and anti-HIV antibodies, as described in Materials and Methods ... cytoplasmic and nuclear fractions as described in Materials and Methods The amount of viral DNA in cytoplasmic and nuclear fractions were analyzed by PCR using HIV-1 LTR-Gag primers and Southern

Ngày tải lên: 13/08/2014, 09:21

... and angling between 2007 and 2008 (Table 1 and Figure 1) Fin clips were sampled and stored in 96% ethanol Total DNA was isolated from this tissue using the Wizard Genomic DNA Purification Kit (Promega), ... BFRO010, and 60°C, 30 s for BFRO011 to BFRO018) and DNA exten-sion (72°C, 5 s) Fragment analysis was performed on a 3130xl Genetic Analyzer and genotyped using Gene-Mapper v4.0 Mitochondrial DNA data ... polymorphic positions and their genetic distance is about 0.75% Hap-lotype Da27 and Da29 and hapHap-lotype Da25 differed at nine and ten polymorphic positions, respectively, and the genetic distance

Ngày tải lên: 14/08/2014, 13:21

... of damage in mtDNA if the mtDNA damage has been overestimated These include analysis of small quantities of DNA, cross contamination of nDNA and mtDNA and artefactual oxidation of DNA during isolation ... gene and the β-actin gene nDNA preparations contain both nDNA and mtDNA whereas mtDNA preparations contain only mtDNA 59 Figure 13 Chromatograms of the target ions of (A) Fapy Guanine and (B) ... mtDNA and nDNA 62 Figure 14 Restriction fragments of nDNA, cmDNA and mtDNA on 0.5% (w/v) agarose gel stained with ethidium bromide 63 Trang 17Figure 15 Gel electrophoresis of total cellular DNA

Ngày tải lên: 16/09/2015, 08:31

... cứu các đoạn DNA DNA tái tổ hợp (recombinant DNA) được tạo ra từ hai hay nhiều nguồn vật liệu di truyền khác nhau Phân tử DNA tái tổ hợp được tạo ra nhờ kỹ thuật ghép nối các đoạn DNA của các ... khác nhau Trang 4Quy trình tạo DNA tái tổ hợpBước 1: Nuôi tế bào chủ và tế bào cho gene quan tâm Bước 2: Tách DNA plasmid và DNA tế bào cho Bước 3: Cắt DNA plasmid và DNA mục tiêu bằng 1 loại enzyme ... Oanh (2208152002) Trang 2Giới thiệu công nghệ DNA tái tổ hợp Ứng dụng công nghệ DNA tái tổ hợp Trang 3Giới thiệu công nghệ DNA tái tổ hợpCông nghệ DNA tái tổ hợp là một tập hợp các kỹ thuật phân

Ngày tải lên: 07/05/2017, 21:59

... structure of plant populations and communities requires an understanding of the pathogens‘ diversity, their origins, and the evolutionary interplay that occurs between pathogens and their hosts Here we ... three possible outcomes:  DNA can be absorbed and recycled for spare parts  The bacterial DNA can match up with a homologous DNA in the recipient cell and exchange it  DNA can insert itself into ... use and interpretation (Lasker, 2002) DNA fingerprinting has been successfully used for Fusarium in characterization of individual isolates and grouping them into standard racial classes Lal and

Ngày tải lên: 14/01/2020, 15:54

... RNA isolation and standard DNA construction ···7 6 Primer design ···8 Trang 57 Reverse transcription ···118 Standard DNA construction ···12 9 Specific identification of genotyping DNA ···13 10 ... ···15 III Results and discussion ···15 1 Standard DNAs for SBV genotyping ···15 2 Sensitivity of genotyping in single PCR and nested PCR 17 3 Accuracy of SBV genotyping on standard DNAs ···19 4 Detection ... detection of Maize DNA ···134 6 DNA isolation from leaf and seed of Maize ···135 7 Isolation of pollen DNA ···135 8 Purification of residual DNA ···136 9 PCR performance ···137 III Results and discussion

Ngày tải lên: 21/05/2020, 11:16

... DNA pieces are joined in vitro to form recombinant molecules • Generate sticky ends on the DNA, e.g with restriction endonucleases • Tie DNA molecules from different sources together with DNA ... phage and P1 phage can carry large fragments of DNA – 20 kb for lambda – 70 to 300 kb for P1 • M13 phage vectors can be used to generate single-stranded DNA YAC vectors for cloning large DNA inserts ... anneal primers, and synthesize new DNA: duplex molecules of desired product PCR, cycle 5: exponential increase in product Cycle 5: Denature, anneal primers, and synthesize new DNA: 14 duplex molecules...

Ngày tải lên: 13/03/2014, 18:39

... Based Therapies and Vaccines 2008, 6:7 Table 1: Proviral DNA at baseline (week 0) and weeks 12, 24 and 48 after rhGH immunotherapy Proviral DNA, HIV-1 copy number/μg of total DNA Patienta Baseline ... management of the study and GM undertook patient care and management NI, AH, SW and JD carried out laboratory work, collected and analysed the data and conducted the transfer and interpretation of ... responses and the change in levels of proviral DNA between weeks and 12 This suggests that targeting HIV1 Nef with a proliferative T-cell response decreases the amount of proviral DNA/ μg total DNA, ...

Ngày tải lên: 11/08/2014, 10:23

... conformations on DNA methylation In this work, the effect of the intercalated [9] (+)-cis-antiB[a]P-N2-dG adduct on the DNA binding and catalytic activity of SssI and HhaI was examined and compared ... residues in the DNA duplexes, and are consistent with a base-flipping model of the dC target residue Binding and methylation studies The interactions of M.HhaI and M.SssI with DNA containing site-specifically ... intercalated into the DNA A Fig Bar graphs representing relative Kd (K rel ) and kcat (k rel ) values for binding and d cat methylation of DNA containing (+)-cis-B[a]PN2-dG and (+)-trans-B[a]P-N2-dG...

Ngày tải lên: 19/02/2014, 00:20

... Therefore, systemic and extensive investigations are still required to assign universally appropriate parameter sets of the temperature-dependent thermodynamics for the DNA/ DNA and RNA /DNA oligonucleotide ... the present study, we determined the temperatureindependent and temperature-dependent thermodynamic parameters of 24 DNA/ DNA and 41 RNA /DNA oligonucleotide duplexes The heat capacity changes were ... AND METHODS Material preparations DNA and RNA oligonucleotides were synthesized on a solid support using the standard phosphoramidite method with an Applied Biosystems Model 391 synthesizer and...

Ngày tải lên: 22/02/2014, 07:20

... )74G and )76G (bottom strand) and )33G, )35G, )46G, )56G and )68G (top strand) (Fig 3B) All the protected guanine bases except )56G are located in and around O1 and O2 Interestingly, )35G, )41G and ... CTCGAGCATTTTAACTACGTTTG Synthesis of O1 DNA Synthesis of O2 and O1O2 DNAs Synthesis of O2 DNA Synthesis of O3 DNA Synthesis of O3 DNA Synthesis of S aureus cspC DNA Synthesis of S aureus cspC DNA (Fig 2A) was synthesized ... performed a DNase I footprinting experiment using 200 nm CI and radioactively labeled O DNA (Fig 2B) The footprints of both the top and bottom strands of O DNA reveal that two regions in O DNA became...

Ngày tải lên: 07/03/2014, 00:20