part time as a proxy for other key variables

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... segments that appear to Proxy Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, ... proxyarray.msft Each of the servers in the array has a unique IP address, so you need to specify an A- type resource record for each server as follows: proxyarray.msft IN proxyarray.msft IN proxyarray.msft ... Outgoing Requests Proxy Array Same Domain, Site, and Proxy Array Name Web Object Distribution and Failover Proxy Arrays with Only One Proxy Server You can enhance the availability for client outbound...

Ngày tải lên: 18/10/2013, 18:15

62 360 0
Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

Báo cáo y học: "The potential of human regulatory T cells generated ex vivo as a treatment for lupus and other chronic inflammatory diseases" pot

... self-tolerance; deficit of a T cell subset as a possible cause of autoimmune disease J Exp Med 1985, 161:72-87 Kuniyasu Y, Takahashi T, Itoh M, Shimizu J, Toda G, Sakaguchi S: Naturally anergic and ... Sakaguchi S, Fukuma K, Kuribayashi K, Masuda T: Organ-specific autoimmune diseases induced in mice by elimination of T cell subset I Evidence for the active participation of T cells in natural ... Arthritis Research Vol No Horwitz et al can serve as a therapy for autoimmune diseases such as systemic lupus erythematosus (SLE) This T-cell-based therapy could also be used to prevent graft...

Ngày tải lên: 09/08/2014, 03:24

6 411 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... controls at 575 nm was used as background The final Ca2+ amounts were calculated according to the manufacturer’sprotocol and are given in μg per μl of the sample A standard curve was prepared using ... [AGL2008-00517] as well as the fellowship to J.D.R KZ also thanks the CSIC for providing JAEDOC grant funding We thank Conchita Martínez-Sierra for her excellent technical assistance Author details Departamento ... cells as well as in the intracellular spaces between them The stigmatic surface is the main place for signal exchange between pollen and stigma Ca2+ ions are more abundant in the receptive stigmas...

Ngày tải lên: 11/08/2014, 11:21

12 529 0
báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps

báo cáo khoa học: " Cannabis as a substitute for alcohol and other drugs Amanda Reiman" pps

... [12] Cannabis substitution has also been discussed as part of a harm reduction framework A record review of 92 medical cannabis patients who used marijuana as a substitute for alcohol was conducted ... 2: Reasons for using cannabis as a substitute N Less adverse side effects Less withdrawal potential Ability to obtain cannabis Greater social acceptance Better symptom management Other reason ... has less withdrawal potential, 17.8% use it as a substitute because its easier to obtain cannabis than alcohol, illicit or prescription drugs, 11.9% use it as a substitute because cannabis has...

Ngày tải lên: 11/08/2014, 18:20

5 279 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than ... the one they thought was correct (identification) (for more information on the test, see (Thomas-Danguin et al., 200 3a) ) Data analysis Repeated measures analysis of variance was used to test the...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

... came across an innovation in hair care in Italy, the hair brush package was designed open so that you could feel the bristles before purchase Back at base nothing happened as our marketing department ... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... disseminate and embody new knowledge far 236 Knowledge and Process Management beyond the organizational boundaries, leading to increased innovative partnerships and alliances (Nonaka and Takeuchi,...

Ngày tải lên: 18/10/2013, 12:15

9 502 2
Module 8: Routing as a Solution for Private Network Connectivity

Module 8: Routing as a Solution for Private Network Connectivity

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... information for unicast packets Unlike RIP -for- IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database ... locations For example, if a new subnet is added to another location and the local private network has not performed an auto-static update, all destinations on the new subnet are unreachable Note Auto-static...

Ngày tải lên: 18/10/2013, 18:15

50 375 0
Module 10: RADIUS as a Solution for Remote Access

Module 10: RADIUS as a Solution for Remote Access

... NetWare-based servers Access NetWare-based file and print resources Run applications that are based on the IPX/SPX protocol AppleTalk Administer Apple Macintosh–based servers Access Apple Macintosh–based ... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... Enhancing a RADIUS Design for Availability Optimizing a RADIUS Design for Performance Discussion: Enhancing the RADIUS Solution An organization has a geographically distributed work force that...

Ngày tải lên: 22/10/2013, 16:15

50 443 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...

Ngày tải lên: 01/11/2013, 09:20

16 525 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified ... TCP/IP as a Solution for Networking Discussion: Evaluating TCP/IP Availability and Performance Requirements Slide Objective To evaluate options for enhancing the availability and performance of a...

Ngày tải lên: 21/12/2013, 05:18

58 444 0
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

... Client an IP address and configuration information to enable IP communication The DHCP Server maintains a database that includes available and allocated IP addresses for defined subnets and the ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... contacts a DHCP Server for lease renewal Modifying the lease adjusts the time before DHCP automatically makes the IP address available to other DHCP Clients if the original lease is not renewed For...

Ngày tải lên: 17/01/2014, 08:20

48 401 0
Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

... Treated as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to other ... an organization increases, the size of the DNS zone databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated ... design that you initially created for the market research company Kansas City Los Angeles Washington DC Atlanta Dallas Delivery Tip Read the scenario to the students and review the questions as a group...

Ngày tải lên: 17/01/2014, 08:20

60 374 0
Tài liệu Learning Networks as a Means for Work Organization Development pptx

Tài liệu Learning Networks as a Means for Work Organization Development pptx

... innovations from Japan”, Organization Studies, Vol 16, No 6, pp 971-989 Nahapiet, J and Ghoshal, S (1998), “Social capital, intellectual capital and the organizational advantage”, Academy of Management ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development ... research and educational institutions, consultancy companies and development agencies These networks may take many forms and may also include other participants, such as customers, labour market organizations,...

Ngày tải lên: 24/01/2014, 00:20

17 448 0
Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

... and load balancing When you use replication, all servers contain the same WINS database information Timely WINS Database Replication Highly available WINS implementation designs call for timely ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use Lmhosts traffic then use Lmhosts and Broadcasts and Broadcasts WINS Server Unicast reduces broadcasts...

Ngày tải lên: 24/01/2014, 10:20

45 410 0
Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

... Introducing NAT Designing a Functional NAT Solution Securing a NAT Solution Enhancing a NAT Design for Availability and Performance An organization has a number of sales representatives that work ... application and an inventory control application The applications are Active Directory– aware applications that store the data for the applications in a SQL Server 7.0 database How could you use NAT ... enhance availability and improve performance The following table describes how these strategies enhance availability and performance Use this strategy To enhance availability by To optimize performance...

Ngày tải lên: 24/01/2014, 10:20

34 308 0
Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

... Chair/BNA Mercury Nashville MCA Nashville MCA Nashville Columbia Nashville Warner Bros Jason Aldean Dierks Bentley Alan Jackson Justin Moore Brad Paisley Rascal Flatts Keith Urban Brad Paisley Zac ... opera arias that date back to 1642 See Appendix for a list of the opera arias To take into account changes in the meaning of different words/phrases over time, assistance with the content analysis ... Band Brad Paisley Capitol Nashville/Broken Bow Dangling Rope/Capitol Records Nashville Arista Nashville/EMI Nashville Valory Music Group Arista Nashville Lyric Street Capitol Nashville Arista...

Ngày tải lên: 13/02/2014, 16:20

27 317 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... interaction with the specific binding partner (stability- or affinity-based), one could divide a phage library in half and sort one half against a binding partner and the other half against an expression ... camelid heavy chain antibody scaffold for use in constructing naı¨ ve antibody libraries [15] Here, the association of the variable heavy chain (VH) with protein A was used as a surrogate for direct...

Ngày tải lên: 19/02/2014, 12:20

7 503 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... 15 to 85 C was performed at a constant rate of 0.2 Cặmin)1 Absorbance of duplexes at 260 nm was measured using Cary 50 Bio spectrophotometer (Varian, Victoria, Australia) with temperature controller ... native PAGE; (b) incubated with 1% SDS at 65 C for and analyzed by 8% native PAGE; (c) incubated with 0.8% SDS at room temperature for 10 and analyzed by 12% SDS/PAGE (Laemmli gel) For autoradiography ... scintillation uid The lter-bound radioactivity was measured on Tracor Analytic Delta 300 scintillation counter (ThermoQuest/CE Instruments, Piscataway, USA) and the amount of methylated DNA was determined...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
w