... v is the initial velocity of the reaction, Vmax is the maximum velocity, [S] is the concentration of citrate, Ks is the dissociation constant of the enzyme-citrate (ES) complex, and a, b, and ... in (A) (puried enzyme before subunit dissociation) and (B) (AclA alone) Molecular masses (kDa) are indicated on the left of the panel The asterisk indicates the degradation product of AclA described ... that is the target for phosphorylation (His273) is located on the AclA subunit, whereas a sequence comparison with bacterial succinyl-CoA synthetase displayed that residues interacting with ATP...
Ngày tải lên: 08/03/2014, 22:20
... one of parameters in table and remain invariable all the rest of parameters The obtained results are shown in Section 3 Influences of laser parameters on saturated photon densities 3.1. Gain coefficients ... varies 142 D.V Hoang, M.H Hanh / VNU Journal of Science, Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation ... of one mode makes the decrease of the one of other mode The reason perhaps is due to the conservation of energy in the operation of two-mode random microlaser However, this result reflects the...
Ngày tải lên: 14/03/2014, 13:20
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... When an bn , we say that an /bn is bounded from above by a constant which is asymptotically universal Similarly, bn , we say that an and bn are comparable up to a constant when an which is asymptotically ... ≥ N , area(P An+2 ) ≥ λ area(P ∪ P ) for all P An , area(P (4.20) An+2 ) ≥ λ area(P ∪ P ) for all P An This, together with Lemma 4.13, shows that there exist a universal constant λ and an integer...
Ngày tải lên: 14/03/2014, 22:20
There is a Reaper ... pptx
... translucent paper He paused and I urged, "Go on. " "I am alone," he said "The realities I knew no longer exist, and I am damp and cold All about me is a sense of gloom and dejection It is an apprehension—an ... that and you may come to a wrong conclusion as to what the worst menace is Richard Kadrey Butcher Bird Spyder Lee is a happy man who lives in San Francisco and owns a tattoo shop One night an ... caverns, to the heart of Hell itself William Hope Hodgson The Night Land The Sun has gone out: the Earth is lit only by the glow of residual vulcanism The last few millions of the human race are...
Ngày tải lên: 15/03/2014, 17:20
Nano product preview march 2009 the applause “ this is a fantastic effort”
... CO2 Saponification and acidification convert the alkylated derivative to the corresponding β-keto acid The β-keto acid then undergoes decarboxylation to form a ketone 21-8 Example Example O O CH3CCH2COCH2CH3 ... OCH2CH3 The anion of ethyl acetoacetate can be alkylated using an alkyl halide (SN2: primary and secondary alkyl halides work best; tertiary alkyl halides undergo elimination) R 21-6 Conversion to ... Acetoacetic Ester Acetoacetic Ester O H3C O C C H C OCH2CH3 H Acetoacetic ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant...
Ngày tải lên: 15/03/2014, 22:14
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
... 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to complete the construction up to amino acid R833 of wild type NPR -A ... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the ... of adenosine 5¢-triphosphate in the activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK (1991) Dual...
Ngày tải lên: 16/03/2014, 23:20
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx
... physicians Effective communication is particularly challenging among organizations that are a significant distance apart (e.g., the distance between cities such as Clairton and Oakland) • There are ... learning disability and chronic asthma has a son who was born premature and has several serious health complications, including asthma and withdrawal from asthma medications Her mother and stepfather, ... programs has home-visiting teams that comprise both a public health nurse and a trained paraprofessional While the paraprofessional focuses on outreach, educating the family about available services...
Ngày tải lên: 22/03/2014, 09:20
Reserve Recruiting and the College Market - Is a New Educational Benefit Needed doc
... was administered using a Computer Adaptive Test version of the ASVAB (CAT-ASVAB) The sequence of questions asked by the CAT-ASVAB depends on prior answers The raw scores from the CATASVAB cannot ... constant for males overall since 1980, educational attainment among males who join the Reserves has increased considerably Educational attainment has risen strongly among both civilian females and ... educational attainment occurred between 1986 and 1992 Although these statistics indicate that reservists attained somewhat less education by ages 25 to 30 than the overall population,9 the statistics...
Ngày tải lên: 23/03/2014, 02:20
Báo cáo khoa học: Total chemical synthesis and NMR characterization of the glycopeptide tx5a, a heavily post-translationally modified conotoxin, reveals that the glycan structure is a-D-Gal-(1fi3)-a-D-GalNAc pot
... heteronuclear two-dimensional NMR spectroscopy The data clearly indicated that the tx 5a glycan is in an a- D-Gal-(1fi3) -a- D-GalNAc configuration Taken together, these data demonstrate that two Conus glycopeptides ... linkage carbon Together these data suggested that the interglycosidic linkage between GalNAc and Gal was 1–3 in the alpha configuration These data were confirmed by the strong NOE between the 1H at ... advantage of this post-translational modification in unique ways that allows them to accommodate evolutionary and environmental changes that are specific for each species These data demonstrate the...
Ngày tải lên: 23/03/2014, 13:20
on the shoulders of giants a course in single variable calculus - smith & mcleland
... of water pump is Piston shown in the diagram on the left A cylinder containing a Upper piston is lowered into a tank The cylinder has a valve at Valves its lower end and there are valves on the ... m/s is a constant and is the mass of the carriage There is a physical law, known as the principle of conservation of energy, which states that is a constant " ! is 162 km/hr, what is ... 2.2: A basic Mathematica plot This graph does not look as nice as the one in Example 2.1 The vertical axis is too crowded, the curve is rather squashed and there is no colour To improve the appearance,...
Ngày tải lên: 31/03/2014, 15:40
the nothing that is, a natural history of zero - robert kaplan
... being a hundred times greater than the last Gautama answers: ayuta, niyuta, karikara, vivara, achobya, vivaha, utsanga, bahula, nagabala, titilambha, vyavaithanaprajnapti (! that's 1031), and so ... through the alluring samaptalambha (1037) and the tongue-twisting visandjnagati (1047) to tallakchana (107 + 46 = 1053) at last But it isn't the last after all: just as with Archimedes, this is a first ... to say that Archimedes' estimate wasn't all that bad This is a spectacular application of the Greek insight that the world afar can be grasped by analogy to the world at hand But it is made much...
Ngày tải lên: 05/06/2014, 11:23
báo cáo hóa học: "Transmembrane potential induced on the internal organelle by a time-varying magnetic field: a model study" pdf
... practice This conclusion is made after extensive analysis on model parameters with the values in broad physiological ranges (Table 1) To our knowledge and based on a Medline search, there have ... of Toronto, Toronto, Ontario, M5S 1A1 , Canada Authors’ contributions HY was involved with model equation derivation, data analysis, and drafting of the manuscript MC was involved in generating ... properties of the material considered in the model are frequency-dependent With the standard values, ψcell was always greater than and ψorg (Figure 3A) At 10 kHz, the maximal polarization on the cell...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " On the maximum modulus of a polynomial and its polar derivative" potx
... Inequalities and Applications 2011, 2011:111 http://www.journalofinequalitiesandapplications.com/content/2011/1/111 Page of The above lemma is due to Chan and Malik [11] Lemma 2.4 If p(z) is a polynomial ... If |aj| = k for at least one j; ≤ j ≤ t, then inequality (2.8) is trivial Therefore, we assume that |aj| >k for all j; ≤ j ≤ t In the rest, we proceed by mathematical induction The result is true ... derivative J Approx Theory 54, 306–313 (1988) doi:10.1016/ 0021-9045(88)90006-8 Shah, WM: A generalization of a theorem of Paul Turan J Ramanujan Math Soc 1, 67–72 (1996) Aziz, A, Rather, NA: A refinement...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, On the nonautonomous N-competing species problems,” Applicable Analysis, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, On the nonautonomous Volterra-Lotka...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo toán học: "On the Generalized Convolution with a Weight - Function for Fourier, Fourier Cosine and Sine Transforms" pot
... convolutions Also we will show that there does not exist the unit element for the calculus of this generalized convolution as well as there is not aliquote of zero Finally, we will apply this ... Russian) V A Kakichev and Nguyen Xuan Thao, On the design method for the generalized integral convolution, Izv Vuzov Mat (1998) 31–40 (in Russian) V A Kakichev and Nguyen Xuan Thao, On the generalized ... Their Application, Russian Academy, Moscow, 1997 16 Nguyen Xuan Thao and Trinh Tuan, On the generalized convolution for I transform, Acta Math Vietnam 28 (2003) 159–174 17 M Saigo and S B Yakubovich,...
Ngày tải lên: 06/08/2014, 05:20
Báo cáo toán học: "On the Domination Number of a Random Graph" docx
... its drawbacks as we shall see; it is the main reason why a two point concentration (rather than a far more desirable one point concentration) will be obtained at the end of this section The problem ... n))+ε → ∞ n be satisfied This holds for The above √ analysis clearly needs that the condition r p log n/ n and r = Ä n − Ä ((Ä n)(log n)) + K, where K is any constant Now the condition log logp n ... changes from zero to infinity if p is smaller than required in Lemma A related set of results, to form the subject of another paper, can be obtained on using a more careful analysis than that...
Ngày tải lên: 07/08/2014, 06:22
Báo cáo lâm nghiệp: "Frost damage on the terminal shoot as a risk factor of fork incidence on common beech (Fagus sylvatica L.)" docx
... P1 and P2 together, confirmed that “damage” was an explanatory factor which was much significant than the other variables and factors available Thus overall, the damage factor had both a statistical ... applied the concept of attributive fraction of risk (AFR) Whereas the relative risk value is a precious indicator at the scale of an individual, this second concept takes the importance of the risk ... was significantly different to the “undamaged” level (Tab IIc) This was obtained on the one hand from the amalgamated data of plots and 2, with a high total number (Pr > Chisq = 0.0008) and on...
Ngày tải lên: 07/08/2014, 16:20