objects accessed locally act as a proxy for remote objects

Module 10: RADIUS as a Solution for Remote Access

Module 10: RADIUS as a Solution for Remote Access

... certificates Note As a best practice, specify RADIUS secrets that are at least 16 characters in length and that include upper case letters, lowercase letters, and punctuation 26 Module 10: RADIUS as ... geographic locations, and the remote access accounting information This information provides the basic decisions for establishing a RADIUS remote access connection • Emphasize that separate remote ... Authentication and Accounting Performance RADIUS servers provide authentication and accounting for RADIUS clients, and interact with the authentication servers As a result, the authentication and accounting...

Ngày tải lên: 22/10/2013, 16:15

50 443 0
Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

Module 7: Microsoft Proxy Server 2.0 as a Solution for Internet Connectivity

... segments that appear to Proxy Server as LAN interfaces are persistent, and the data rate is determined by the LAN technology Public network segments that appear as demand-dial interfaces are nonpersistent, ... proxyarray.msft Each of the servers in the array has a unique IP address, so you need to specify an A- type resource record for each server as follows: proxyarray.msft IN proxyarray.msft IN proxyarray.msft ... Outgoing Requests Proxy Array Same Domain, Site, and Proxy Array Name Web Object Distribution and Failover Proxy Arrays with Only One Proxy Server You can enhance the availability for client outbound...

Ngày tải lên: 18/10/2013, 18:15

62 360 0
Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

Flavor enhancement as a tool for increasing pleasantness and intakeof a snack product among the elderly

... Preliminary data analysis revealed no significant main effects and only one significant interaction of day and aroma on the pleasantness ratings of the young, implicating an increase in pleasantness ... samples was created by a laboratory panel (n ¼ 9; females, males, aged 25 –41 years) trained to evaluate attributes selected in advance The attributes were evaluated on a 9-point scale that was ... Hedonic ratings In the pleasantness ratings, the aroma concentration had a similar effect on both age groups in the first tasting session: the heightened aroma sample was rated as less pleasant than...

Ngày tải lên: 03/04/2013, 21:06

10 599 1
Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

Knowledge Management as a Catalyst for Innovation within Organizations: A Qualitative Study

... essential part of the organization (Hedlund and Nonaka, 1993) McCartney (1998) states that `the activities that give rise to innovation are basically R McAdam Knowledge and Process Management RESEARCH ... Our MD came across an innovation in hair care in Italy, the hair brush package was designed open so that you could feel the bristles before purchase Back at base nothing happened as our marketing ... cycles, innovation streams, and ambidextrous organisations: organisational renewal through innovation streams and strategic change In Managing Strategic Innovation and Change, Tushman ML, Anderson...

Ngày tải lên: 18/10/2013, 12:15

9 502 2
Module 8: Routing as a Solution for Private Network Connectivity

Module 8: Routing as a Solution for Private Network Connectivity

... of applications that can take advantage of multicast transmissions RIP -for- IP version is an example of a protocol that can take advantage of multicast transmissions to update routing information ... information for unicast packets Unlike RIP -for- IP routers, OSPF routers maintain a map of the network in the link state database Updates to the network are reflected in the link state database ... initially created for the market research company Washington DC Kansas City Los Angeles Atlanta Dallas Delivery Tip Read the scenario to the students and review the questions as a group Give...

Ngày tải lên: 18/10/2013, 18:15

50 375 0
Social factors as a basis for treatment

Social factors as a basis for treatment

... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... therefore, which clubhouse elements are effective and which standards are necessary for success 175 Social factors as a basis for treatment Conclusion Social factors can affect the course and ... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported...

Ngày tải lên: 01/11/2013, 09:20

16 525 0
Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

Tài liệu Module 2: TCP/IP as a Solution for Networking pdf

... information or explanation on optimizing IP performance IP Stack IP Stack Delay and Latency IP MTU Data Data Data Data IP TCP Data Link Link Link IP TCP Data Link Header Trailer Trailer Header ... used, you can specify IP addresses based on: Classes (A, B, C) with an associated default mask Classes with variable length subnet masks (VLSM) Classless Inter-Domain Routing (CIDR) with a specified ... Internet from all locations Support for all of the hosts, as shown in the preceding diagram Support for a mission-critical Web-based application that requires 24-hoursa-day, 7-days -a- week availability...

Ngày tải lên: 21/12/2013, 05:18

58 444 0
Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

Tài liệu Module 3: DHCP as a Solution for IP Configuration pptx

... Client an IP address and configuration information to enable IP communication The DHCP Server maintains a database that includes available and allocated IP addresses for defined subnets and the ... network traffic and IP address release As lease length Network traffic IP addresses release Increases decreases later Decreases increases sooner Note To immediately reclaim DHCP resources, you can configure ... routers for DHCP and BOOTP forwarding A mission-critical Web-based application available on a 24-hours -a- day, 7days -a- week scale No provisions exist for ensuring high availability Isolation of...

Ngày tải lên: 17/01/2014, 08:20

48 401 0
Tài liệu Module 4: DNS as a Solution for Name Resolution docx

Tài liệu Module 4: DNS as a Solution for Name Resolution docx

... databases increases as well Similarly, as the DNS zone database size increases, the length of time to resolve DNS queries increases Delegated zones divide a DNS zone database into smaller parts, ... zones Treated as a traditional primary zone from another BIND-based DNS server To a BIND-based DNS server, Active Directory integrated zones appear as traditional primary zones You can replicate to ... create the subdomain for WINS under the private namespace For organizations that have the same namespace for private and public name resolution, create the subdomain for WINS at a level beneath...

Ngày tải lên: 17/01/2014, 08:20

60 374 0
Tài liệu Learning Networks as a Means for Work Organization Development pptx

Tài liệu Learning Networks as a Means for Work Organization Development pptx

... innovations from Japan”, Organization Studies, Vol 16, No 6, pp 971-989 Nahapiet, J and Ghoshal, S (1998), “Social capital, intellectual capital and the organizational advantage”, Academy of Management ... learning network In actual fact, a project’s ability to function as a learning network depends on many other factors too, as for instance the forms of interaction between different participants ... purchases and more reliable deliveries The core company has a special VAVE team and each supplier company has a VAVE coordinator External support for the Network’s discussions, training and development...

Ngày tải lên: 24/01/2014, 00:20

17 448 0
Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

Tài liệu Module 5: WINS as a Solution for NetBIOS Name Resolution doc

... Release, Register, Renew, Release, and Query by Unicast and Query by Unicast traffic then use Lmhosts traffic then use Lmhosts and Broadcasts and Broadcasts WINS Server Unicast reduces broadcasts ... database replication As the length of time for synchronizing redundant WINS databases increases, the probability increases that a WINS server failure will result in the use of an outdated database ... redundancy and load balancing When you use replication, all servers contain the same WINS database information Timely WINS Database Replication Highly available WINS implementation designs call for timely...

Ngày tải lên: 24/01/2014, 10:20

45 410 0
Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

Tài liệu Module 6: NAT as a Solution for Internet Connectivity docx

... application and an inventory control application The applications are Active Directory– aware applications that store the data for the applications in a SQL Server 7.0 database How could you use NAT ... Introducing NAT Designing a Functional NAT Solution Securing a NAT Solution Enhancing a NAT Design for Availability and Performance An organization has a number of sales representatives that work ... Routing and Remote Access IP Filters Routing and Remote Access filters restrict traffic at International Organization for Standardization (ISO) layer two and affect all IP traffic received by a NAT...

Ngày tải lên: 24/01/2014, 10:20

34 308 0
Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

Tài liệu Songs as a Medium for Embedded Reproductive Messages doc

... Chair/BNA Mercury Nashville MCA Nashville MCA Nashville Columbia Nashville Warner Bros Jason Aldean Dierks Bentley Alan Jackson Justin Moore Brad Paisley Rascal Flatts Keith Urban Brad Paisley Zac ... a content analysis of the lyrics contained in a sample of representative art songs and opera aria dating back as far as 1597 Arias are usually a melodic segment set within the context of a larger ... Band Brad Paisley Capitol Nashville/Broken Bow Dangling Rope/Capitol Records Nashville Arista Nashville/EMI Nashville Valory Music Group Arista Nashville Lyric Street Capitol Nashville Arista...

Ngày tải lên: 13/02/2014, 16:20

27 317 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... association of the variable heavy chain (VH) with protein A was used as a surrogate for direct stability measurements The VH domains in camelid heavy chain antibodies are most similar to the classical ... Remarkably, we have found that, at least in some circumstances, a quantitative correlation to biophysical data can be obtained from a statistical analysis of selected phage populations [16] We also ... denaturant as a selective pressure to The potential for obtaining quantitative biophysical information from phage-display was suggested by a new method called alanine shotgun scanning, which analyzes...

Ngày tải lên: 19/02/2014, 12:20

7 503 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... final model Linear discriminant analysis (LDA) This statistical multivariate method is supervised It searches for the variables containing the greatest interclass variance and the smallest intraclass ... cell spectrum and spectral areas selected by genetic algorithm A smear of about · 105 cells was dried on an area of cm2 on the germanium surface as explained in Materials and methods Wavenumbers ... et al assigned the shoulders present at 1117 and 1020 cm)1 to RNA and DNA, respectively [18] Classification by LDA Classification by LDA on spectra reduced by PCA PCA was performed on the training...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... cells Proc Natl Acad Sci USA 91, 7311–7315 32 Kamata M, Nitahara-Kasahara Y, Miyamoto Y, Yoneda Y & Aida Y (2005) Importin-alpha promotes passage through the nuclear pore complex of human immunodeficiency ... CBP coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel role for Vpr...

Ngày tải lên: 06/03/2014, 09:22

10 434 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... scintillation uid The lter-bound radioactivity was measured on Tracor Analytic Delta 300 scintillation counter (ThermoQuest/CE Instruments, Piscataway, USA) and the amount of methylated DNA was determined ... The ratio of bound to free DNA was plotted vs concentration of bound DNA (a Scatchard plot, Fig 3) [23] An 18-mer DNA duplex 5Â-GAG CCAACCTGGCTCTGA-3Â/3Â-CTCGGTTGGACCGAG ACT- 5Â (IÂ) was used as ... determined and the fraction of bound DNA was calculated as (cpmbound)/(cpmbound + cpmfree) K dapp was calculated by tting the data to the following equation derived from a standard bimolecular binding...

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Milk Diet As A Remedy For Chronic Disease- p1 potx

Milk Diet As A Remedy For Chronic Disease- p1 potx

... size, it has a decided advantage in ease of absorption “This breed can be traced back for 2,000 years and was always famous for dairy purposes In temperament, these animals are quiet and docile, ... Nature is always endeavoring to maintain a normal standard against any agent or condition that may attempt to alter it And when temporarily or accidentally that standard may be departed from, ... next day start with the milk as early as usual, again stop at noon, and eat a somewhat heartier meal in the evening, if the appetite calls for it Another meal that may be taken the first day is...

Ngày tải lên: 15/03/2014, 00:20

101 457 0
Relational Cloud: A Database-as-a-Service for the Cloud potx

Relational Cloud: A Database-as-a-Service for the Cloud potx

... Jajodia, S Paraboschi, and P Samarati Balancing Confidentiality and Efficiency in Untrusted Relational DBMS CCS, 2003 [7] S Das, D Agrawal, and A E Abbadi ElasTraS: An elastic transactional data ... from the graph occasional statements that scan large portions of the database and (2) sampling tuples and transactions In Relational Cloud, a new database and workload are placed arbitrarily on ... multiple partitions when the load on a database exceeds the capacity of a sin- DATABASE PARTITIONING Relational Cloud uses database partitioning for two purposes: (1) to scale a single database to...

Ngày tải lên: 16/03/2014, 16:20

6 572 0
Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

Báo cáo khoa học: Molecular characterization of recombinant mouse adenosine kinase and evaluation as a target for protein phosphorylation potx

... manufacturer’s recommendations AK activity assays Kinetic analysis of AK activity was performed under empirically defined linear steady-state conditions Reactions were carried out at 37 °C in a final ... PAGE (15% acrylamide) and PhosphorImager analysis To calculate reaction stoichiometries, radiolabeled reaction products and radioactive standards were quantitated using IMAGEQUANT software (Amersham ... translational regulation, rate of turnover, subcellular localization, or association with as yet undefined regulatory factors The most abundant nucleoside kinase in mammals, AK has emerged as a key...

Ngày tải lên: 16/03/2014, 18:20

9 498 0
w