objective c for php programmers

C for java programmers

C for java programmers

... 2002 29 Using gcc  Two-stage compilation  pre-process & compile: gcc –c hello.c  link: gcc –o hello hello.o  Linking several modules: gcc –c a.c  a.o gcc –c b.c  b.o gcc –o hello a.o ... Using math library  gcc –o calc calc.c -lm Trang 30Oct 23, 2014 Advanced ProgrammingSpring 2002 30 Error reporting in gcc  Multiple sources  preprocessor: missing include files  parser: syntax ... referencing errors No output written to file. Trang 33Oct 23, 2014 Advanced ProgrammingSpring 2002 33 C preprocessor  The C preprocessor (cpp) is a processor which macro- manages a collection

Ngày tải lên: 23/10/2014, 13:56

126 585 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 3 potx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 3 potx

... or @public sections simil ar to C++. Objective-C doesn’t support multiple inheritance InstatwitViewController.h Trang 19you are here 4 95objective-c for the iPhone @property (nonatomic, retain) ... up, right? Objective-C can automatically release references, too. In addition to retain and release, Objective-C has the concept of an autorelease pool This is basically an array of objects that ... now! Back into Interface Builder to make the connection from the UIPickerView to the IBOutlet in our view controller Right-click on the UIPickerView, grab the circle next to the “New Referencing

Ngày tải lên: 14/08/2014, 20:21

54 465 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 4 doc

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 4 doc

... visible.Datasource Firecracker Lemon Drop Absolut Mixer Bee Stinger Cupid’s Mojito Miami Vice Captain e r c e C p a n The tablevi ew takes the new cell and scrolls it in As the user scrolls, some cells ... the scr een, it asks the datasource for a cell f or that row. The datasource check s the cell bucket to see if ther e are any cells available to reuse If so, i t just replaces the row’s contents ... your device What are Trang 11Table Cell Code Up Close// Customize the appearance of table view cells - (UITableViewCell *)tableView:(UITableView *)tableView cellForRowAtIndexPath cell = [[[UITableViewCell

Ngày tải lên: 14/08/2014, 20:21

54 402 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 5 docx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 5 docx

... key value coding, which is a specific pattern typically used in Cocoa Binding The subtle catch is that NSDictionary usually just turns a call to valueForKey: into a call to objectForKey, and ... disclosure indicators: “The disclosure indicator element is necessary if you’re using the table to present hierarchical information.” DrinkMixer uses really basic cells, but you can easily customize ... information TableViewCells have a lot of built-in functionality—we’re just scratching the surface Adding a disclosure indicator is simply a matter of telling the cell what type of accessory icon it should

Ngày tải lên: 14/08/2014, 20:21

54 366 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 6 ppsx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 6 ppsx

... NSNotification object Each notification comes with a notification object. Notification userInfo objects are dictionaries with notification-specific information in them. The notification object contains ... specific needs for your own, you can just use the default system-level one You can get a reference to the default one by calling: [[NSNotificationCenter defaultCenter]; With the notification center, ... UIScrollView can figure out everything else from there Content view Scroll View Elements (buttons, etc.) Remember, in CocoaTouch, components are subclasses of UIView All a scroll view needs to care

Ngày tải lên: 14/08/2014, 20:21

54 430 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 7 ppsx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 7 ppsx

... are UITableViewController subclasses, and that the “With XIB for user interface” box is NOT checked. Create your two new classes for the Fugitive and Captured view controllers in Xcode, and then ... the Captured List FugitiveListViewController.h and m and CapturedListViewController.h and m both need to be subclasses of UITableViewController, so select “UIViewController subclass” and check ... The tab bar controller is another common iPhone interface Unlike the navigation controller, there isn’t really a stack All of the views are created up front and easily accessed by clicking the

Ngày tải lên: 14/08/2014, 20:21

54 453 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 8 docx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 8 docx

... (iBountyHunterAppDelegate*)[[UIApplication sharedApplication] delegate]; NSManagedObjectContext *managedObjectContext = appDelegate. managedObjectContext; NSFetchRequest *request = [[NSFetchRequest alloc] init]; NSEntityDescription ... Responsible for keeping track of managed objects active in the application All your fetch and save requests go through this Describes entities in your application including type information, data constraints, ... directories are by using the NSSearchPathForDirectoriesInDomains, just like the template does in the App Delegate: Library Preferences Caches tmp Trang 13Copy the database to the correct placeWhen

Ngày tải lên: 14/08/2014, 20:21

54 434 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 9 potx

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 9 potx

... ([managedObjectContext hasChanges] && ![managedObjectContext save:&error]) This code from iBountyHunterAppDelegate.m is checking for changes as you exit the app. The Managed Object Context ... This is the sort clause for a SQL command. Entity Info Sort Descriptor An NSFetchRequest describes the search we want Core Data to execute for us. Entity Information tells Core Data the type ... we’re searching for (and want back) For us, this is a Fugitive class. Here’s the piece we haven’t used before The predicate captures conditions the data must match If it doesn’t match, it doesn’t

Ngày tải lên: 14/08/2014, 20:21

54 449 0
head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 10 pps

head first iphone development a learners guide to creating objective c applications for the iphone 3 phần 10 pps

... separate class conforming to the protocol that has a reference to its Fugitive (composition) rather than adding code to the Fugitive class directly. (CLLocationCoordinate2D) coordinate { CLLocationCoordinate2D ... intentionally or by accident) self.locationManager = [[CLLocationManager alloc] init]; self.locationManager.desiredAccuracy = kCLLocationAccuracyNearestTenMeters; self.locationManager.delegate = self; ... beats nothing Core Location actually decides which method to use based on what’s available to the device and what kind of accuracy you’re after That means none of that checking for source stuff;

Ngày tải lên: 14/08/2014, 20:21

63 355 0
javascript for php developers

javascript for php developers

... "number" Try-catch has some performance implications when the catch block is executed, andshould be avoided in performance-critical code paths (i.e., you should move it outsideloops) while and for Loops ... concept in JavaScript for which there is no equivalent in PHP It’s one of the ways JavaScript accomplishes code reuse and inheritance The Language | 3 Trang 20• JavaScript doesn’t have a concept ... Functions 34 Closures 35 Closures in PHP 35 Scope Chain 37 The Scope Chain in the WebKit Console 39 Retaining the Scope 43 Retaining References, Not Values 44 Closures in a Loop 45 Exercise:

Ngày tải lên: 01/11/2013, 09:56

160 271 0
node js for php developers

node js for php developers

... Simple Callbacks This chapter explains how to refactor blocking PHP source code such that it can beeasily converted to nonblocking Node.js source code that uses callbacks It presentsthe concept ... improve PHP source codesuch that it can be placed in Node.js callbacks when converted to Node.js Chapter 4, Advanced Callbacks This chapter presents a more sophisticated and generic way to refactor ... find-and-replace action that will correctly Trang 33convert 298 code elements and incorrectly convert two code elements than it is to do acomplicated find-and-replace action that correctly converts

Ngày tải lên: 01/11/2013, 09:57

286 543 2
Tài liệu C for The Microprocessor Engineer P2 doc

Tài liệu C for The Microprocessor Engineer P2 doc

... BRN; LBRN Never carried out not Equal BNE; LBNE Z flag clear (Non-zero result) Carry Set BCS; LBCS 1 [Acc]Lower Than (Carry = 1) Carry Clear BCC; LBCC 2 [Acc]Higher or Same as (Carry = 0) Lower ... [A]<-[A]+[M]; [B]<-[B]+[M] CC ORCC #nn Can set [CCR]<-[CCR]+#nn The setting of the CCR flags can be used after an operation to make some deduction about, and hence act on, the state of the operand ... Branches provided, which can be considered as the True or False outcome of eight flag combinations Thus Branch if Carry Set (BCS) and Branch if Carry Clear (BCC) are based on the one test (C =?).

Ngày tải lên: 23/12/2013, 01:16

20 607 0
Tài liệu C for The Microprocessor Engineer P1 docx

Tài liệu C for The Microprocessor Engineer P1 docx

... spectrum ranging from 8 through32-bit architecture As both microprocessors share a common ancestor, the com-plexity is reduced compared with a non-related selection Where necessary, otherprocessors ... Real-Time Clock interrupt service routine. 226 8.8 Generating factorials using the else-if construct. 228 8.9 Generating factorials using the switch-case construct. 230 8.10 Generating factorials ... on an oscilloscope. 160 6.3 Exception related instructions. 162 7.1 Source code for the absolute assembler. 173 7.2 A typical error file. 173 7.3 Listing file produced from the source code in

Ngày tải lên: 23/12/2013, 01:16

30 405 0
Tài liệu php|Tropics The magazine for PHP professional docx

Tài liệu php|Tropics The magazine for PHP professional docx

... usedccoonnnneecctt oobbjjeecctt(()) The difference between ccoonnnneecctt(())and ccoonnnneecctt oobbjjeecctt(()) is that ccoonnnneecctt(()) passes thewidget that emitted the signal to the callback function.This ... Contact Information: General mailbox: info@phparch.com Editorial: editors@phparch.com Subscriptions: subs@phparch.com Sales & advertising: sales@phparch.com Technical support: support@phparch.com ... smaller and, there-fore, quicker Nowadays, most web browsers support this functionality and advertise it by sending the AAcccceepptt EEnnccooddiinngg:: ggzziipp or AAcccceepptt EEnnccooddiinngg::

Ngày tải lên: 24/01/2014, 14:20

66 397 0
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx

... AlCl3, KCl, CaCl2, CrCl3, MnSO4, MnCl2, FeSO4, FeCl3, CoCl2, NiCl2, CuSO4, CuCl2, RbCl, Na2MoO4(NH4)6Mo7O24, SnCl2, CsCl, BaCl2and PbCl2did not affect the activity Substrate specificity To study ... AtagACCATGCGTATCCGTGAGCTTGGCATCACC-3¢; antisense primer, 5¢-ACGCAATCTAGAGTCAGCCCTCA GGGGGCTTTCG-3¢ The amplified PCR product was digested with HindIII and XbaI (Takara Bio Inc.), separ-ated by agarose-gel electrophoresis ... vancomycin-resistant enterococci, VanX from the glycopeptide antibiotic producer Strep-tomyces toyocaensis and DdpX from Escherichia coli are considered to be involved in vancomycin-resistance,

Ngày tải lên: 07/03/2014, 21:20

10 407 0
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx

... Amplification 8406 (fi) GTCTCGCGGCCCAGCCGGCCATGGCCACAAGGGTAGACCAAACACC N-terminus ¼ TRVDQTP … 5¢ Amplification 8407 (fi) GTCTCGCGGCCCAGCCGGCCATGGCCGCAAGGGTGGACCAAACACC N-terminus ¼ ARVDQTP … 5¢ Amplification ... GTCTCGCGGCCCAGCCGGCCATGGCCGCATGGGTAGACCAAACACC N-terminus ¼ AWVDQTP … 3¢ Amplification 8404 (‹) CACGTTATCTGCGGCCGCTTTCACGGTTAATGCGGTGCC C-terminus ¼ … GTALTVK 3¢ Amplification 8405 (‹) CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC ... CACGTTATCTGCGGCCGCTTTCACGGTTAATACGGTGCCAGCTCC C-terminus ¼ … GTVLTVK CDR3 Library construction 6981 (‹) GGTTAATACGGTGCCAGCTCCCYYMNNMNNMNNMNNMNNRYHRYH RYHRYHMNNMNNMNNMNNMNNMNNTGCTCCACACTTATACGTGCCACTG

Ngày tải lên: 17/03/2014, 10:20

12 522 0
visual studio  net c++ for dummies quick reference guide

visual studio net c++ for dummies quick reference guide

... Worldwide, Inc An International Data Group Company Foster City, CA # Chicago, IL # Indianapolis, IN # New York, NY Trang 2Table of Contents WtrOAUCCION cacccccccccsscccccccccccccccsccccccccececececeee ... This Book Is Organized .cccccccscccccccescssssessssessvesssecsvsscsessesscess 2 Conventions Used in This Book .ccccccccccssssssssssssseseesetssessessesseeses 3 The lcon CTÊW ch nh HH H121 ee 3 ... Uisual C++ 5 Customizing the Developer’s Workshop .0 ccecccssssesesessssecsteeesees 6 Customizing Toolbar§ á cá on ng HH HH nga nne 7 Adding tools to a toolbar c.ccccccccccccsccsessesscssecsessssesecessessesseese

Ngày tải lên: 25/03/2014, 16:07

219 437 0
Objective-C Steven Holzner ppt

Objective-C Steven Holzner ppt

... Using Public Access 102 Using Private Access 103 Using Protected Access 105 Using Class Variables 107 Accessing the Current Object 109 Creating a Variable for Multiple Object Types ... Functions 77 Chapter 5: Classes and Objects 79 Creating Objective-C Classes and Objects 82 Using Class Methods 84 Creating an Object 86 Creating Object Methods 87 Storing Data in Objects 88 ... shown here so Objective-C knows about the When the program ends, Objective-C will expect some indication of whether the func-tion succeeded We’ll return a value of 0 to Objective-C, which means there

Ngày tải lên: 29/03/2014, 06:20

240 562 0
beginning c for arduino

beginning c for arduino

... C 21  Chapter 3: Arduino C Data Types 37  Chapter 4: Decision Making in C 55  Chapter 5: Program Loops in C 77  Chapter 6: Functions in C 91  Chapter 7: Storage Classes and Scope 113  Chapter ... following sections An Atmel-Based Microcontroller Card You will need to have access to an Atmel microcontroller card (Let’s use “ c for “microcontroller” from now on.) Atmel produces a wide ... menu choice 9 www.it-ebooks.info chapter 1 ■ Introduction Figure 1-7 Selecting your mc board You should select the menu choice that matches the mc board you will be using If you change mc boards

Ngày tải lên: 05/05/2014, 11:08

276 707 0
Báo cáo hóa học: " Research Article Dynamic Modeling of Internet Traffic for Intrusion Detection" docx

Báo cáo hóa học: " Research Article Dynamic Modeling of Internet Traffic for Intrusion Detection" docx

... significant increase in the linear mutual information for the attack traffic as compared to the normal traffic In conclusion, the mutual information can pick up the differ-ence in the statistical structure ... be computed from the linear canonical correlation coefficients (CCCs) If the traffic signal is non-Gaussian, the linear CCCs underestimate the mutual information However, after a nonlinear preprocess-ing, ... Linear canonical correlation The linear canonical correlation analysis (CCA) is a second moment technique for computing the mutual information under the standard Gaussian assumption Since the process

Ngày tải lên: 22/06/2014, 23:20

14 415 0
w