now scuba diving is a popular sport

... readTask 1: these words are from the passage Look back to the text and circle the best meanings A, B or C. 1 Vacancy. A A part of a newspaper where jobs are advertised C A seat that is available ... Trang 1To To OUR CLASS Trang 2Statement Job1 Now, work in pairs and do task 2 a A pupil 2 Close your eyes, give me your hand, darling b A Biologist 3 My first passenger is a lady c An English ... An English teacher 4 I study many subjects such as Maths, Physics, Chemistry… d A farmer 5 I study the growth of plants and animals e A doctor 7 I graduated from engineering department

Ngày tải lên: 11/04/2021, 17:12

... Trang 1SALTER-HARRIS FRACTURE Alex Duckworth, MS4 Trang 2What is a Salter-Harris fracture?ƒ Fracture through growth plate in a pediatric Trang 3Anatomy of Long Bonesƒ Epiphysis distal to ... history of axial load ƒ Crush injury of growth plate, no damage to epiphysis or metaphysis ƒ Poor prognosis, almost inevitable growth disturbance ƒ Diagnosis difficult, often made after premature ... plate seen Trang 20Salter-Harris Type VeMedicine – Salter-Harris Fractures : Article by William Moore, MD http://www.hawaii.edu/medicine/pedi atrics/pemxray/v1c18.html Trang 21Salter-Harris

Ngày tải lên: 25/01/2014, 06:24

... SJ, Ward ER, Ryals JA & Dangl JL (1994) Arabidopsis mutants simulating disease resistance response Cell 77, 565–577 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, ... gene as an internal standard PCRs were performed using the following primers: ACT2 (At3g18780): 5-ACATTGT AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, ... PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement This project was supported by grants from the Aus-trian Science Foundation References 1 Foyer CH &

Ngày tải lên: 14/02/2014, 19:20

... reactivating factor while it exists as an active holoenzyme The glycerol dehydratase-reactivating factor reactivates the inacti-vated hologlycerol dehydratase in a similar manner Both dehydratase-reactivating ... forming a cavity  11 A˚ in height The size of this cavity is comparable with that of adenine-lacking cobalamins, and thus allows the damaged cofactor to pass through it Intact cofactor, an ade-nine-containing ... Biotechnology, Graduate School of Natural Science and Technology, Okayama University, Japan Keywords adenosylcobalamin; coenzyme B12; diol dehydratase; diol dehydratase-reactivating factor; reactivase Correspondence

Ngày tải lên: 15/02/2014, 01:20

... A600 A600 A600 Time (h) Fig 5 His41 is essential for Paracoc-cus pantotrophus NirF, but Asp129 is dis-pensable Growth plots and time courses of nitrite appearance and disappearance for P pantotrophus ... In addition, it has been dem-onstrated that a Paracoccus derivative strain, in which nirN is replaced with a kanamycin resistance cassette, still makes holo-cd1, which suggests that this last ... mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily detectable amounts of an intermediate of d1synthesis Experimental procedures DNA manipulations DNA

Ngày tải lên: 15/02/2014, 01:20

... outcomes-based qualifications frameworks, makes programmes and qualifications more transparent and facilitates the recognition of qualifications ECTS can be applied to all types of programmes, whatever ... that learners can have a record/ proof or confirmation of what they have achieved at each stage of their educational pathway Credit transfer in ECTS 4.4 From the key features: “Credits awarded ... within a particular programme within that institution or organisation The process of awarding credit to non-formal or informal learning has these three stages: Initial advice and guidance (what does

Ngày tải lên: 16/02/2014, 03:20

... to a Table 1 Statistics on data collection and refinement A wavelength of 0.8726 A ˚ was used Rotations of 1 were performed The Ramachan-dran plot was calculated using RAMPAGE X-ray data Cell ... twice; that is, if Ala25 of chain A is close to Asn77 of chain B, then Asn77 of chain A is close to Ala25 of chain B. AlaO–ArgND2 AsnOD1–HisNE2 Trp30 Arg42, Trp30, Arg76 Phe36 Phe142, Pro136, Asn135 ... protein cavity Residues that present at least one atom at a distance shorter than 4.0 A ˚ from the ligand are listed Distances were calculated using CONTACT [19]. Trang 6quite common in nature It is,

Ngày tải lên: 16/02/2014, 14:20

... physically exist They are simulated relays and are what enables a PLC to eliminate external relays There are also some special relays that are dedicated to performing only one task Some are always ... initially Theladder diagram now looks like this: Notice also that we now gave each symbol (or instruction) an address This address sets aside a certain storage area in the PLCs data files so that ... and the actual program we arealmost ready to start writing a program But first lets see how a relay actually works After all, the main purpose of a plc is to replace "real-world" relays

Ngày tải lên: 18/02/2014, 23:20

... for histologi-cal sections The antibody was tested on formalin-fixed paraffin-embedded normal human skin sections as well as on invasive-lobular mamma carcinoma and small cell bronchial carcinoma ... monocyte⁄ macrophage phenotype was also veri-fied by a Nitro Blue tetrazolium reduction assay Monocytes⁄ macrophages are able to generate reactive oxygen species and this burst activity can be visualized ... haematopoietic malignant K562 cells displayed morphological changes characteristic of mega-karyocytic differentiation Numerous cells were larger and adhered on plastic surfaces compared with parental suspension

Ngày tải lên: 19/02/2014, 00:20

... anti-placental alkaline phosphatase-agarose (anti-PLAP; Sigma) was packed into an FPLC column (Amersham Biosciences, Chalfont St Giles, UK) Purifica-tion of FN3d–AP was carried out using an AKTA ... predict that an anti-body raised to a sequence outside this domain might have little effect on the RAP assay signal This was tested with an antibody to nucleolin raised against amino acids 271–520 ... phosphatase catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C)

Ngày tải lên: 19/02/2014, 05:20

... ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCCGTTTCCCAGCCTGTTGGGCCT AAACTGCAGAAGCTTGATTTTGAATTCTGT AAACTGCAGAAGCTTGATTTTGAATTCTGT GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT

Ngày tải lên: 19/02/2014, 05:20

... 4x1-12-pR, 5¢-AAACATAAATTTCGCCATTTCTCCTAG TAT-3¢ The full-length mouse cDNA was obtained with primers 4x1-f-pF, 5¢-ATGGAGGCCTCCTGGCTGGAG ACTCGTTGG-3¢ and 4x1-f-pR, 5¢-AAACATAAATTT CGCCATTTCTCCTAGTAT-3¢ ... function Experimental procedures Animals and tissue Human cardiovascular system and 12-lane multitissue nor-thern blots, human aorta cDNA library and RACE ready aorta cDNA were obtained from Clontech ... mid-way along the chain Northern blot analysis showed high level expression of the CYP4x1 RNA in brain and in aorta, and this was confirmed by analysis of the EST database; this showed significant

Ngày tải lên: 19/02/2014, 07:20

... (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon College; Ballarat and Queens Anglican Grammar School; Ballarat ... assessment Authority (VCAA) manages and awards school qualifications It administers and awards two senior school secondary qualifications known as the Victorian Certificate of education (VCE) and the ... English Attendance ICSEA Number of Teachers Number of Support Staff Read7 Write7 Spell7 Grammar7 Math7 School Associations: ASPV AGSV GV ACC ACOED BAS CAS Sandhurst EID GIS SIS Region: Cental East

Ngày tải lên: 20/02/2014, 19:20

... 10021, USA Email: Min Liu - corticalgranules@hotmail.com; Andrea Oh - andrea.oh@email.ucr.edu; Patricia Calarco - calarco@itsa.ucsf.edu; Michiyuki Yamada - myamada@yokohama-cu.ac.jp; Scott A Coonrod ... obtained from MS/MS sis was searched against listed PADs and residues that were matched to it are marked (*) The signal peptide cleavage site is marked with an arrow The monopartite nuclear localization ... A where it is red DNA stain in A is green ABL2 labe-ling is green and LCA labelabe-ling is red in all figures (A) Cytospin preparations of the granulocyte fraction were stained with anti-PAD

Ngày tải lên: 05/03/2014, 17:20

... necrosis factor-a and interleukin-1a are known stimuli of CARP expression, pharmacologi-cally targeting these pathways might be an option Indeed, as it has already been demonstrated that drug-mediated ... cyto-plasm of large myofibres, suggesting that CARP plays a role in myogenic activation, as well as in mature fibres It is possible that a common molecular signal-ling pathway encompassing CARP and ... denervation-induced atro-phy and is also elevated in all the MD models investi-gated This last observation adds to the panel of muscle pathologies already reported to be associated with an increase

Ngày tải lên: 07/03/2014, 03:20

... mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations The subcellular localization of mammalian Rbm9 is unclear and is dependent on the isoform ... data suggestthat the translational activation by tethered XRbm9 is not dependent on XGld2 This experiment also shows that the translational activation by MS2-XRbm9 is comparable with that obtained ... loaded as input. Trang 6luciferase activity by about sixfold compared with theMS2 protein alone (Fig 3A) This activation was comparable with that obtained with MS2-PABP This activation was cis-dependent,

Ngày tải lên: 07/03/2014, 05:20

... cerevisiae DNA was used as a PCR template for PCR For construction of pUG35-LPX1 (LPX1–GFP), PCR-amplified YOR084w (primers 5¢-GCTCTAGAATG GAACAGAACAGGTTCAAG-3¢ and 5¢-CGGAATTCCA GTTTTTGTTTAGTCGTTTTAAC-3¢) ... Yor084wp) was extractable by low salt and identified together with the peroxisomal aspartate aminotransfer-ase Aat2p in HPLC fraction 7 at a molecular mass of approximately 45 kDa (Fig 1A) [15] The ... The band marked by an asterisk contains the peroxisomal proteins Lpx1p (predicted molecular mass 44 kDa) and Aat2p (pre-dicted molecular mass 44 kDa) in HPLC fraction 7 at a molecular mass of approximately

Ngày tải lên: 07/03/2014, 05:20

... Trang 1assembly and ATPase activity and has elements conservedin other members of the meiotic clade of AAA ATPases Parimala R Vajjhala1,2, Chau H Nguyen1,2, Michael J Landsberg1, Carol Kistler1,2, ... substrate as it feeds through the core of anoligomeric ring formed by these AAA ATPases Thusmany AAA ATPases function as protein disassemblymachines [25] ATPase activity of Vps4 is critical fordisassembling ... typically contain one or two ATPase domains that assemble into one or two stacked hexameric rings The ATPase catalytic site is located at the interface between adjacent ATPase domains of a ring and

Ngày tải lên: 07/03/2014, 05:20

... to act as phytotoxins [e.g cerato-platanin of Ceratocystis fimbriata f sp platani, Snodprot1 of Phaeosphaeria nodorum and Sp1 of Leptosphaeria maculans) or human allergens and path-ogenesis-related ... the mascot search engine [49] for a PMF search in several proprietary and public genomic databases using a tailor-made bioinformat-ics facility The mascot search was run against all proteins and ... protein contains two helices, separated by a 14 amino acid strand interproscan analysis [22] of Epl1 showed the affi-liation of this protein to the cerato-platanin family (IPR010829) This is a group

Ngày tải lên: 07/03/2014, 12:20

... hybridi-zation of an oligo microarray containing 20 371 mouse cDNAs Scatter plot analysis of the microarray data showed that most of the data points fell along the diagonal, indicating that most ... sodium–potassium–chloride cotransporter 1 (Slc12a2) that plays an important role in dorsal root ganglia function, spermatogenesis and inner ear forma-tion, and mutation of this gene causes impairment ... the manufacturer The arrays were washed, dried and scanned using ScanArray 5000 (GSI Lumonics Inc., ON, Canada) Cy3 and Cy5 intensities for each spot on the array were determined by QUANTARRAY

Ngày tải lên: 07/03/2014, 17:20