nigeria s ogoniland a region of contrasts

báo cáo khoa học: "Use of 3D-computed tomography angiography for planning the surgical removal of pineal region meningiomas using Poppen''''s approach: a report of ten cases and a literature review" pptx

báo cáo khoa học: "Use of 3D-computed tomography angiography for planning the surgical removal of pineal region meningiomas using Poppen''''s approach: a report of ten cases and a literature review" pptx

... hemiparesis, five cases displayed dizziness, four cases presented with ataxia and one case had paralysis of upgaze Among the ten patients, six had a KPS score ≥80, indicating a satisfactory quality ... recruited having suffered symptoms for a period of days to years Among these patients, six cases were found to suffer from headaches, four cases had papilledema, three cases had hearing loss, one case ... Poppen s or Krause s approach alone This alternative treatment is applicable to certain large and giant tumors of the pineal area As demonstrated in their study, the combined approach was successful...

Ngày tải lên: 09/08/2014, 02:20

8 435 0
THE RED MAN''''S CONTINENT A CHRONICLE OF ABORIGINAL AMERICA potx

THE RED MAN''''S CONTINENT A CHRONICLE OF ABORIGINAL AMERICA potx

... daily changes are frequent at all seasons Surprising as it may seem, this study indicates that similar conditions are best for all sorts of races Finns from the Arctic Circle and Italians of sunny ... America be counted as one major land mass, and Europe, Asia, and Africa as another, the two present the same general features Yet their mountains, plains, and coastal indentations are so arranged ... open space thousands of young trees bank their soft green masses so gracefully that one has an ever-present sense of pleased surprise as he comes upon this younger foliage out of the dim aisles among...

Ngày tải lên: 06/03/2014, 12:21

101 415 0
Black Women’s Health: A Synthesis of Health Research Relevant to Black Nova Scotians ppt

Black Women’s Health: A Synthesis of Health Research Relevant to Black Nova Scotians ppt

... in this area of research A two-day workshop was used as a forum to raise awareness of the issues and the determinants of health, and to validate the preliminary research findings as well as to ... Nova Scotia and inappropriate tests have been used to assess the health of this population For example, the signs used in APGAR scores to assess the health of babies may be inappropriate A baby ... able to avail themselves of preventive health tests such as Pap smears, breasts exams and routine physical examinations This disparity between minority groups and mainstream society is also exhibited...

Ngày tải lên: 22/03/2014, 10:20

81 300 0
Báo cáo hóa học: " Research Article On the Throughput Capacity of Large Wireless Ad Hoc Networks Confined to a Region of Fixed Area" pptx

Báo cáo hóa học: " Research Article On the Throughput Capacity of Large Wireless Ad Hoc Networks Confined to a Region of Fixed Area" pptx

... independent of all network parameters such that the uniform per node throughput of an ad hoc network confined to an square region of (dimensionless) area A satisfies the inequalities (these bounds can actually ... has an unlimited amount of data to send to d(i) Each node is constrained to a maximum transmit power of P The available bandwidth is equal to W The time is assumed to be divided into slots of ... wireless nodes uniformly distributed over a square area of area A So the density of the nodes has the value ρ = n /A More precisely, in the following we assume that the node density is fixed, that is,...

Ngày tải lên: 22/06/2014, 00:20

11 464 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... Characteristics of study participants Biochemical analysis Plasma total cholesterol concentrations, as well as serum creatinine and uric acid concentrations, were measured using standard methods in the ... parameters were set according to the manufacturer s protocol Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA ... systemTM; Agilent Technologies, Waldbronn, Germany) Int J Med Sci 2007, Statistical analysis Data are presented as the mean ± SD The Hardy-Weinberg equilibrium was assessed by doing chi-square...

Ngày tải lên: 26/10/2012, 10:04

7 613 1
Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

Báo cáo khoa học: The N-terminal region of the bacterial DNA polymerase PolC features a pair of domains, both distantly related to domain V of the DNA polymerase III s subunit ppt

... Howard Hughes Medical Institute and Ministry of Education and Science of Lithuania Analysis of surface features and conservation Residue conservation analysis was performed with the consurf server ... domain, but also at the residue level Materials and methods Sequence search and alignment Standard sequence similarity searches were performed using blast and psi-blast [17] with default parameters ... Acids Res 35, 2825–2832 20 Abe Y, Jo T, Matsuda Y, Matsunaga C, Katayama T & Ueda T (2007) Structure and function of DnaA N-terminal domains: specific sites and mechanisms in inter-DnaA interaction...

Ngày tải lên: 05/03/2014, 23:20

10 423 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

... sclerosis (SSc), various forms of primary vasculitis as well as in patients with diseases that share clinical features with BD, such as inflammatory bowel disease and uveitis Finally, we evaluated ... coordination and drafted the manuscript All authors read and approved the final manuscript Acknowledgements We thank Professor Francesco Vecchi for assistance with statistical analysis This work was ... boxy-terminal subunit of Sip1 (anti-Sip1 C-ter) antibodies in patients with Behçet 's disease (BD), systemic lupus erythematosus (SLE), systemic sclerosis (SSc), vasculitis, inflammatory bowel disease...

Ngày tải lên: 09/08/2014, 08:22

8 552 0
Who’s Afraid of ID, A Survey of the Intelligent Design Movement

Who’s Afraid of ID, A Survey of the Intelligent Design Movement

... The Status of Design in Natural Science Albany, NY: State University of New York Press Rea, M 2000 Naturalism and material objects In Naturalism: A Critical Analysis, ed W L Craig and J P Moreland ... bridges with its opponents and to find sympathetic ears in the academy If sound scholarship produces results that attract the interest of already-established scholars, this will start to happen ... makes the designer responsible for natural evils such as parasitism This suggests that either the designer lacks some of the traditional attributes of God or does not exist at all Rather than be forced...

Ngày tải lên: 01/11/2013, 08:20

21 592 0
A study of some linguistic features of barack obama's english speeches

A study of some linguistic features of barack obama's english speeches

... CHAPTER INTRODUCTION of Some Linguistic Features of Barack Obama s English Speeches” 1.2 AIMS AND OBJECTIVES 1.2.1 Aims This study aims at analyzing the stylistic features of Barack Obama s English ... - What are the stylistic features of Barack Obama s English speeches? - What are some suggestions for teaching and learning English as well as writing speeches, especially political speeches? ... subject to data and statistics Less measurable but no less profound is a sapping of confidence across our land – a nagging fear that America s decline is inevitable, that the next generation must lower...

Ngày tải lên: 26/11/2013, 13:21

13 714 2
A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

A study of the english translational versions of tring cong son's songs in terms of semantic and syntactic features

... translation, semantics as well as syntax - Collecting and classify semantic features of lexicon and syntactic features of phrases and sentences by taking Trinh Cong Son s songs as the data 9 10 - Describing ... order of the strategies suggested by Catford from the highest to the lowest as follows: Strategy Class-shifts Intra-system-shifts Structural-shifts Unit-shifts In the data, the strategy “Class-shifts” ... which strategy is used Number Strategy Structural-shifts Class-shifts Unit-shifts Intra-system-shifts In this part, each strategy with examples will be presented and discussed 4.3.1 Structural – shifts...

Ngày tải lên: 26/11/2013, 13:23

13 710 1
A study of english and vietnamese idioms describing people's outward appearance

A study of english and vietnamese idioms describing people's outward appearance

... states that a phrase consists of one or more words and there are five formal categories such as noun phrases, verb phrases, adjective phrases, adverb phrases and prepositional phrases 2.2.7 Summary ... process In addition, we can know what predominantly by means of simile such as (as) fresh as a daisy ;(as) mistakes our students may commit so that we set out suitable gaudy as a butterfly or face ... features of IPOA 1.5 RESEARCH QUESTIONS What are the syntactic characteristics of English and Vietnamese IPOA? What are the semantic characteristics of English and Vietnamese IPOA? THEORETICAL...

Ngày tải lên: 26/11/2013, 13:26

13 1,7K 7
An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

An analysis of the inaugural address by g w bush in the u s president election 2004 from a perspective of discoure analysis

... PERSPECTIVE OF D .A prescribed required proclaim state years of sabbatical years of rest ultimate/ eventual final attain reach persistent constant swift fast anew again edifice of character set of ... presidential speeches The 2004 inaugural address employs a rather good deal of words in their formal form as a means of attaining solemnity as well as the leadership of the speaker Here is an account of ... in his speech However, it is necessary to specify here the addresser and addressees of the speech Needless to say Mr Bush is the addresser with absolute power: as the Head of the State and as the...

Ngày tải lên: 18/12/2013, 10:08

44 579 0
Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

Tài liệu The Insider’s Guide to PR: Chapter 7 A GLOSSARY OF PR SPEAK doc

... consistent set of messages The aim is to achieve seamless communication with the audience • Internal Communications: information dissemination and flow between an organisation and its employees ... photographs, illustrations and news releases • Press Release: see News Release • Proposal: document outlining a proposed PR campaign to an existing or potential client • Public Affairs - the process ... magazines for hi-fi enthusiasts Trade journals are read for business and professional reasons, for example Electronics Week is read by electronics engineers • Teaser: a promotion that is intended...

Ngày tải lên: 23/12/2013, 00:15

2 495 0
Tài liệu Father’s Involvement as a Determinant of Child Health pptx

Tài liệu Father’s Involvement as a Determinant of Child Health pptx

... United States (n=1286 fathers; 19% Hispanic, 70% African American, and 8% Caucasian) with a comparison sample of married parents (n=473 fathers; 25% Hispanic, 37% African American, and 32% Caucasian) ... psychosocial conditions, and availability of materials resources, access to health services, and so on One area of interest, then, is the roles that fathers play in shaping the social circumstances, ... connectedness, Attachment, Positive peer relations, Supportive social networks Resiliency, Less delinquent behavior, Less substance use, Less stress, Less depression, Self acceptance, Life satisfaction...

Ngày tải lên: 12/02/2014, 11:20

36 824 0
Tài liệu Men’s knowledge and awareness of maternal, neonatal and child health care in rural Bangladesh: a comparative cross sectional study pptx

Tài liệu Men’s knowledge and awareness of maternal, neonatal and child health care in rural Bangladesh: a comparative cross sectional study pptx

... involved calculation of summary statistics used in comparing grouped districts Independent t-tests were used to assess differences between means The chi-squared tests were used to assess categorical ... transitional areas) A paragraph describing the findings of the transitional areas is presented at the end of the results section Men s knowledge on selected maternal, neonatal and child health issues Age ... informal situations such as market places and tea stalls in order to reach as many men as possible In response to these findings multimedia messages through television and radio could be utilized as...

Ngày tải lên: 12/02/2014, 19:20

9 724 0
Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

Tài liệu The King''''s Post Being a volume of historical facts relating to the Posts, Mail Coaches, Coach Roads, and Railway Mail Services of and connected with the Ancient City of Bristol from 1580 to the present time pdf

... London; also by Mr L.C Kerans, expostmaster of Bath, and Messrs S. I Toleman and G.E Chambers, ex-assistant Superintendents of the Bristol Post Office I have gathered many interesting facts from "Stage ... was lessee and manager of the Bath and Bristol theatres, and went about beating up actors, actresses, and companies in postchaises, and he thought letters should be carried at the same pace at ... Secretaryship and General Managership of Post Office affairs, was as a youth a disciple of his predecessor, and assisted him in the development of the Mail Coach system He was apprenticed to the Post Office...

Ngày tải lên: 17/02/2014, 02:20

158 678 0
Tài liệu Bike Lanes, On-Street Parking and Business: A Study of Bloor Street in Toronto’s Annex Neighbourhood docx

Tài liệu Bike Lanes, On-Street Parking and Business: A Study of Bloor Street in Toronto’s Annex Neighbourhood docx

... Long stretches of Bloor are made up of small business, and research has shown that bike lanes can  be good for business. Cyclists can stop on a whim more easily than motorists, park at the nearest  ... However, the TPA has been using this data as its primary source for capacity analysis so the  researchers feel this is a reasonable data set to use. In future studies, it could be useful to  combine the TPA s pay‐and‐display data with observational recordings so to include any  ... Parking and Business 20 totals for each of the seven study days (see Table 8. Bloor Street and Spadina Road average  hourly on‐street parking usage).  Table Bloor Street and Spadina Road average...

Ngày tải lên: 18/02/2014, 00:20

38 688 0
Tài liệu PSEUDO-SECRETS: A Freedom of Information Audit of the U.S. Government’s Policies on Sensitive Unclassified Information doc

Tài liệu PSEUDO-SECRETS: A Freedom of Information Audit of the U.S. Government’s Policies on Sensitive Unclassified Information doc

... SSI/USDA (2-4, 7) WMD/State (2, 4) SHSI/NRC WMD/State WMD/Treas PCII/FAA SBU/CDC SBU/GSA SSI/TSA SSI/USDA DEA Sensitive Sensitive/DOD SGI/NRC Technical/DOD UCNI/DOE As a final note, agencies should ... operation of the security classification system has been the widespread use of dozens of special access, distribution, or control labels, stamps, or markings on both classified and unclassified ... release; the guidance includes such materials related to nuclear facilities as: “Site-specific drawings, diagrams, sketches, or maps that substantially represent the final design features of the...

Ngày tải lên: 18/02/2014, 05:20

54 464 0
w