... of Biomathematical and Biomechanical Modeling aims at providing basic knowledge and state of the art on the biology and the mechanics of blood and air flows The cardiovascular and respiratory systems ... Master “Mathematical Modeling”, part of Master of “Mathematics and Applications”, Centre de Recherches Mathématiques, and Taida Institute for Mathematical Sciences, the latter two in the framework ... etc.) M Thiriet, Signaling at the Cell Surface in the Circulatory and Ventilatory Systems, Biomathematical and Biomechanical Modeling of the Circulatory and Ventilatory Systems 3, DOI 10.1007/978-1-4614-1991-4_1,...
Ngày tải lên: 05/03/2014, 22:21
... ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA CACGGCATATTATGATGATGAGAACATGATGGATCTCG ... ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA GAGCCAATATCAAATCTGGTGGTAATCC GAGGAACAAAAATAGTACCGGTAATAAC ... TCAGGAACATCGTATGGGTA CATTATTGGAATGAGGAAA ATGACGTTCCAGATTACGCT AAAAGAATAAGATCGCTT TTACCGGTACTATTTTTGTTCCTCAAACTAGGAG GTATGACCACATTCTATACTGAGAAGAGTGCCTATATAAATCATCGTCAGGTAAAGAGCCCCATTATCTT GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG...
Ngày tải lên: 18/02/2014, 06:20
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
... lacks the large P6 extension and the last three nucleotides (AU XG) of the intron The sizes of the intron (InDGb) and 5Â exon (5E) are indicated The arrow indicates cleavage of the pre-RNA at the ... phosphodiester that becomes properly positioned in the catalytic center [9,10] Owing to the complexity of the ribozyme reactions and the polyanionic nature of RNA, the catalytic chemistry and folding ... and structure of Cr.LSU ribozyme T.-C Kuo et al attacks the 5Â splice site (G-dependent cleavage), generating 5Â exon and intron-3Â exon intermediates Then, the 3Â-OH of the 5Â exon attacks the...
Ngày tải lên: 19/02/2014, 07:20
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx
... to the virtual presences of the fans pressing at the gates, the reporters lurking in the wings, and the implied global spectators watching the show, who are often referenced within speeches The ... of the appeal of these montages is the impossible task they attempt: all of film history in four minutes! Like the pre-cinematic appeal of miniaturization-based attractions, such as the Declaration ... within the headlong rush of the montage) So, too, the Hollywood elite watching in the Academy Awards telecast theater congratulates itself during the montage with periodic bursts of appreciative...
Ngày tải lên: 07/03/2014, 15:20
Vital Assets - Federal Investment in Research and Development at the Nation’s Universities and Colleges potx
... decisionmakers understand the likely consequences of their decisions and choose among alternative policies; and • Helps improve understanding in both the public and the private sector of the ways in which ... whether other critical national needs that have substantial R&D components (such as environment, energy, homeland security, and education) are receiving the investment they require and whether the ... funds and thereby to develop the science and technology resources in the states that support the creation of economic opportunities (i.e., businesses and jobs) for their citizens To participate...
Ngày tải lên: 15/03/2014, 22:20
Begun and held at the City of Washington on Wednesday, the twenty-third day of January, two thousand and two potx
... accounting firms and associated persons thereof; and (7) set the budget and manage the operations of the Board and the staff of the Board (d) COMMISSION DETERMINATION. The members of the Board shall ... that is subject to the jurisdiction of such regulator; and (iii) at the direction of the Commission, to— (I) the Attorney General of the United States; (II) the attorney general of or more States; ... consideration the size and nature of the business of the accounting firms they supervise and the size and nature of the business of the clients of those firms The standards applied by the Board under...
Ngày tải lên: 15/03/2014, 22:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... protein structures on the heme proximal side and ⁄ or the bond length between the heme iron and the proximal ligand may contribute to the formation of the 5-coordinated NO–heme complex We therefore ... addition, the rate of auto-oxidation for L99F was fast but comparable to that of the L115F mutant (Table 2) The high rate constant for the dissociation of O2 from the L99F mutant compared with the other ... ligands, whereas the Fe(II)–CO complexes should have CO and His77 as the axial ligands, as in the wild-type This suggests that the structures surrounding heme, including the heme coordination structure, ...
Ngày tải lên: 16/03/2014, 13:20
How can children be obese and hungry at the same time? pot
... When their mother abandoned Delphine and her younger sisters, her father and grandmother wanted them to get to know them, so the girls go to California When they get there, Cecile sends the girls ... that the Centers for Disease Control and Prevention (CDC) reports that the National Health and Nutrition Examination Survey found that nine of the top ten states with the highest obesity rates ... feeding their minds and their bodies! Happy healthy eating! I Artichokes They’re not easy to eat – you have to trim the leaves first – but the flavor is worth the effort! Steam them and eat with...
Ngày tải lên: 17/03/2014, 17:20
The Turning World Globalisation and Governance at the Start of the 21st Century docx
... role, that of a facilitator for the private sector; the State therefore had to dispose of all the production and/ or commercialisation structures and activities that could be handled by the private ... social, strategic and subsidiarity These are precisely the three rationales that we find at work in the concept and the scenario of the State based on solidarity - a State that, at the same time, ... view: the administrative cultures of the countries concerned, the administrative systems that they know and the strategies that they employ to implement the adopted reforms The administrative...
Ngày tải lên: 23/03/2014, 04:20
Begun and held at the City of Washington on Tuesday, the sixth day of January, two thousand and nine docx
... clothing and the materials and components thereof, other than sensors, electronics, or other items added to, and not normally associated with, clothing (and the materials and components thereof); ... Representatives and the Senate detailing the allocation, obligation and expenditures of these funds, beginning not later than 45 days after enactment of this Act: Provided further, That the Secretary ... Representatives and the Senate detailing the allocation, obligation and expenditures of these funds, beginning not later than 45 days after enactment of this Act: Provided further, That the Secretary...
Ngày tải lên: 23/03/2014, 10:20
Begun and held at the City of Washington on Tuesday, the sixth day of January, two thousand and nine potx
... in the form and manner which the Board shall prescribe, by regulation, and in a manner that avoids duplication; and ‘‘(ii) be placed in a conspicuous and prominent location on the billing statement ... inserting the following: ‘‘; and ‘‘(iv) the consumer report does not contain a date of birth that shows that the consumer has not attained the age of 21, or, if the date of birth on the consumer ... subsection (a), the Board shall publish a notice in the Federal Register that— (A) summarizes the review, the comments received from the public solicitation, and other evidence gathered by the Board,...
Ngày tải lên: 29/03/2014, 06:21
Báo cáo sinh học: "15 kDa Granulysin versus GM-CSF for monocytes differentiation: analogies and differences at the transcriptome level" docx
... Processing and Presentation, and Monocyte and Surface Molecules Pathways, although the former pathway revealed a constant up-regulation of genes, whereas for the latter pathway a down-regulation at late ... from the median at hours and the negative regulation of proliferation related genes down-regulated at later time points, pointing to a general induction of cell proliferation Moreover, at later ... downregulation of the IL-12 and STAT4 Dependent Signaling Pathway in Th1 Development and the Co-stimulatory Signal during T-cell Activation Pathway While these data suggest that GM-CSF treated monocytes...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo hóa học: " Research Article The Methods of Hilbert Spaces and Structure of the Fixed-Point Set of Lipschitzian Mapping" docx
... Sedłak and Wi´ nicki proved that under the assumptions of Theorem 1.2, ¸ s Fix T is not only connected but even a retract of C, and next the author proved the following theorem 7, Corollary Theorem ... 2, 2.2 k then T has a fixed point in C This result generalizes Lifshitz’s Theorem in case of a Hilbert space and shows that the theorem admits certain perturbations in the behavior of the norm ... C 1.2 F and the Lipschitz constant of T tends to if ε ↓ For more information on the structure of fixed point sets see 4, and references therein In 1973, Goebel and Kirk introduced the class of...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo y học: "Childhood infections and asthma: at the crossroads of the hygiene and Barker hypotheses" docx
... by Barker and colleagues [14], and it is often referred to as the Barker hypothesis This hypothesis of fetal origins proposes that these diseases originate through adaptations that the fetus ... to develop asthma [28] The risk of atopy and asthma is related to failure of the neonate to generate interferon-γ and the resultant failure to transition from the Th2 to the Th1 immunophenotype ... both the in utero and postnatal state (Table 1) One common hypothesis to support this gene by environment interaction in the neonate has been the role of endotoxin and polymorphisms of the CD14...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo sinh học: " History and structure of the closed pedigreed population of Icelandic Sheepdogs" pps
... Ballou and Lacy [6] and is the mean of the kinship coefficients between that individual and all candidates, including the individual itself Candidates are defined as reproductive individuals of the ... Finland (113) Pedigree data contained unique ID, father, mother, gender, date of birth, country of birth, and occasionally date of death Only Iceland had data since 1955 In other countries, breeding ... founders Data and current population Of the 4680 dogs in the data, 36 did not have any parents registered and were recognised as founders by the breeding organisations All other dogs in the pedigree...
Ngày tải lên: 14/08/2014, 13:21
a systemic funtional perspective on the meaning and structure of the story the selfish giant by oscar wilde = bình diện ngữ pháp chức năng hệ thống về cấu trúc và ngữ nghĩa của truyện ngắn gã khổng lồ ích kỷ
... development in the text The Theme and the Rheme are responsible for the organization of the clause as communicative event Hence, the thematic structure is the category which gives the clause its ... in the light of its function in the structure of the clause The thematic structure is responsible for the organization of the clause as message It consists of two elements: Theme and Rheme Theme ... arrange the ways in which the various groups and phrases in the clause are ordered with the THEME system The THEME system includes Theme and Rheme The Theme is the element which serves as the point...
Ngày tải lên: 02/03/2015, 14:25
The meaning and structure of the inaugural address by John F. Kennedy in 1961 A systemic functional analysis = Cấu trúc và ngữ nghĩa bài diễn văn nhậm chức của
... arms) and the others are of degree such as like 2.5.2 The Mood pattern of the text The mood patterns of the text reveal the relationship between the politician and the public in his own nation and ... the house Theme Rheme When theme stands at the first place as a subject of the clause, it is unmarked due to the obvious role it is supposed to play On the other hand, any themes other than the ... emphasize the aim of the president to continue to protect the freedom and equality for the nation and the determination that the whole nation will unite to secure their own liberty Besides, the verb...
Ngày tải lên: 30/03/2015, 14:28