multiple animations on a single object

... of a continuous variable and a binary variable All these terms can be easily linearized by incorporating some additional non negative real variables defined as in Eq (A1), (Ghezavati & Mehrabad, ... Guelph, Ontario, CANADA c Department of Mechanical and Industrial Engineering, Concordia University, H3G 1M8 Montreal, Quebec, CANADA d Department of Computer Architecture and Automatic Control, ... the objective function to calculate the inventory cost at refinery and depots is an approximation of the real value, based on an average value of each product inventory over the time horizon Hence,

Ngày tải lên: 14/05/2020, 21:40

... change of use or assessment after a partial failure or structural damages To achieve this evaluation, the mechanical properties of concrete need to be evaluated for a more accurate estimation ... show both average values and standard deviations (calculated on 100 iterations) It can be seen that for NC=2 fitting error RMSE (Figs 4a and 4c) is null (average and standard deviation) while ... RMSE and r2(average and standard deviation) of fitting and prediction models for separated NDT. The average value of RMSE at the prediction stage is always higher than at fitting stage (Figs 4a

Ngày tải lên: 19/11/2022, 11:43

... equation (22) are calculated by applying standard manipulations We then summarize all terms appearing on the rhsof equation (22) in products containing an occupation probability and a transition ... quasiparticle spin (parallel/antiparallel to the magnetization of the FI layer), and takes the values ±1 when used as a variable The island features a strong charging energy, characterized by An ... the transition n =  via the creation of a quasiparticle (blue dashed line) can occur, in the case that the transition n =  via the annihilation of a quasiparticle did not take place earlier

Ngày tải lên: 19/11/2022, 11:46

... Foundation/ American Heart Association Task Force on Practice Guidelines Circulation 2013;127:e362 –e425. 48 Uchida Y, Uchida Y, Sakurai T, Kanai M, Shirai S, Morita T Characterization of coronary ... a full degradation (over 95%) was obtained after 243 minutes; at 0.1 U/mL, the degradation was limited to 683% degra-dation; and at 0.01 U/mL, almost no degradation was observed The addition ... not consume plasma fibrinogen and was not associated with any brain hemorrhage or gastrointestinal effect at 24 hours after administration in healthy animals The fear of hemorrhagic complications

Ngày tải lên: 04/12/2022, 15:50

... lateral stability Additionally, the study explores various active mechanism concepts to manage stiffness variations at the ankle joint, accommodating different walking conditions and speeds.ApproachThis ... Additionally, various active concepts for compliance adaptation are explored to enhance the performance of the SMA AFO across different walking conditions.A thorough gait analysis is conducted ... simulation of the SMA hinge focuses on its performance in both the sagittal and frontal/transverse planes This evaluation assesses the hinge's ability to facilitate uni-axial ankle rotation while

Ngày tải lên: 19/06/2023, 09:43

... semantic and thematic clustering of words on Iranians vocabulary learning American International Morikawa, Y (1955) Studies in paired associates learning: forward-backward recall gradient Japanese ... Zargosh, M., Karbalaei, A., & Afraz, S (2013) The effect of thematic clustering on enhancing monolingual and bilingual EFL learners’ vocabulary acquisition European Online Journal of Natural and ... language teaching (Al Jabri, 2005) and a key factor in second language acquisition (Zargosh, Karbalaei, & Afraz, 2013) Willis (1990) famously noted that while grammar is important, vocabulary is

Ngày tải lên: 12/10/2023, 18:02

... example, if the organization is known for strong management, your answer should mention that fact and show that you would like to be a part of that team. If the company places a great deal ... How long would you stay with us? Say that you are interested in a career with the organization, but admit that you would have to continue to feel challenged to remain with any organization. ... you earning more at your age? Say that this is one reason that you are conducting this job search. Don't be defensive. 23. What do you feel this position should pay? Salary is a

Ngày tải lên: 07/02/2013, 09:37

... Software modifications, on the other hand are only applicable in Automatic Transmissions (AT), Automated Manual Transmissions (AMT) and Continuously Variable Transmissions (CVT), where making ... Gear Total Ratio 4th Gear Total Ratio 5th Gear Total Ratio Final Drive Ratio Automatic Gearbox 1st Gear Total Ratio 2nd Gear Total Ratio 3rd Gear Total Ratio 4th Gear Total Ratio Final Drive Ratio ... Based on Pattern Recognition and Learning Algorithm, 4th World Congress on Intelligent Control and Automation, China, 2002 [6] Mashadi B and Kazemkhani A A Fuzzy gear shifting strategy for manual

Ngày tải lên: 05/09/2013, 17:03

... professionals capable of achieving and managing network optimization Training and certification, along with on- the-job experience should be part of any network management and optimization strategy ... transporting private data. The tunnel must be secured by public and/or private keys and a combination of a data integrity hash and encryption. A typical data authentication is either Secure Hash ... Telephony and QoS For years, it has been said that voice and data are converged on the same network. The first time was when voice analog signals from a telephone and analog signals from a modem

Ngày tải lên: 10/12/2013, 17:15

... Precompiled packages are also available for a large number of Unix platforms. These packages contain binaries for each of the Samba executables as well as the standard Samba documentation. Note that ... /samba Main tree /usr/local /samba/ bin Binaries /usr/local /samba/ lib smb.conf, lmhosts, configuration files, etc /usr/local /samba/ man Samba documentation /usr/local /samba/ private Samba ... Install the server files. 6. Create a Samba configuration file. 7. Test the configuration file. 8. Start the Samba daemons. 9. Test the Samba daemons. 2.1 Downloading the Samba Distribution

Ngày tải lên: 21/01/2014, 07:20

... need to create a configuration file for it. 2.4 A Basic Samba Configuration File The key to configuring Samba is its lone configuration file: smb.conf. This configuration file can be very ... /usr/local /samba/ bin/nmbd -D At this point, Samba will be running on your system and will be ready to accept connections 2.5.2 Stand-alone Daemons To run the Samba processes as stand-alone daemons, ... three ways to start: • By hand • As stand-alone daemons • From inetd 2.5.1 Starting the Daemons by Hand If you're in a hurry, you can start the Samba daemons by hand As root,... /etc/inetd.conf

Ngày tải lên: 21/01/2014, 07:20

... server-based authentications is preauthentication Preauthentication is an optional part of the 802.11i amendment, so there are a number of stations and APs that lack support for it Those Trang 8sta-tions ... PMK caching is that the initial association to each AP on the wireless LAN still requires a full 802.1X/EAP authentication so that a PMK can be created This means that PMK caching only enables ... accompany that data In addition, Wi-Fi networks have a random backoff sequence that allows a wireless AP and the stations that connect to it to share a wireless channel Since a detailed discussion of

Ngày tải lên: 24/01/2014, 09:20

... on a Web Server 17 Using Anonymous Authentication Topic Objective To explain Anonymous authentication and how it works No User Name or Password Required Lead-in Anonymous authentication ... Lead-in IIS supports several types of authentication Using Anonymous Authentication Using Basic Authentication Making Basic Authentication More Secure Using Digest Authentication Using Integrated ... Server Explain each of the authentication methods with an emphasis on Anonymous, Basic, and Integrated Windows. Create a chart on a whiteboard that illustrates the benefits, requirements, and restrictions

Ngày tải lên: 24/01/2014, 10:20

... was immediatelypushed off from shore, and was soon alongside a pleasure-yacht, thatwas lying to, not many cable lengths away wen-At a sign from Servadac, an orderly, who had been standing at a ... was a native of Algeria; but such was by no means thecase His true name was Laurent; he was a native of Montmartre in Paris,and how or why he had obtained his patronymic was one of those anom-alies ... dates, and oranges from the plantations thatformed a continuous rich and luxuriant orchard along their path Thedistrict was quite deserted, and they had no reason to fear any legalpenalty In an

Ngày tải lên: 17/02/2014, 04:20

... procurator Thomas Contarini; and in Padua, of the cavalier Antonio Capo di Vacca. But it is not one man in a hundred thousand, that so much can be said of. If others have a mind to live long and healthy, ... original; he has likewise omitted several passages of the Italian, and the whole is rather a paraphrase than a translation. This has induced us to give the public an exact and faithful version of ... many years; and that, to me, the habit of it was become a second nature; and that it was more agreeable to reason, that, as I advanced in years and lost my strength, I should rather lessen than

Ngày tải lên: 17/02/2014, 22:20

... technological mandates and instead enhance funding and encourage collaborative, faceted, and multi-stakeholder initiatives and approaches to enhance online safety via innovation and cooperation multi-recommendations ... been a significant move away from a rather fear-based approach and [toward] using more research of actual harm.” Balkam said there are still some challenges “Some companies are rather disconnected ... opinion and fiction And in a social-media environment, media literacy has a new essential component: critical thinking about what is posted, shared, produced and uploaded as well as content that’s

Ngày tải lên: 18/02/2014, 00:20

... tRNA Arg with the N-terminal domain makes a minor contribu- tion to the aminoacylation reaction, but is not essen- tial, and that DN ArgRS facilitates the aminoacylation reaction of tRNA Arg CCU well ... reaction, the Arg-NHOH formation reaction, and the deacylation reaction. (A) Arg (cyan), ATP (orange) coordinated by Mg 2+ and A76 (green) of tRNA assisting the Arg-AMP for- mation reaction on P. horikoshii ... fit to activate. The fact that k cat and K m for tRNA Arg in the aminoacylation reaction do not change in the Asn106 fi Ala, Gln111 fi Ala and Phe109 fi Ala mutants of S. cerevisiae ArgRS [14] indicates

Ngày tải lên: 18/02/2014, 11:20

... (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG TGCCAACTCCCAC) containing a BamHI site. The gene was cloned at the NheI and BamHI sites ... S, Khachatr- yan A, Vyas S, Arrowsmith CH, Clarke S, Edwards A, Joachimiak A et al. (2001) Structure of Thermotoga maritima stationary phase survival protein SurE: a novel acid phosphatase. Structure ... survival operon regulated by the stationary-phase RNA polymerase alternative sigma factor. SurE is known to improve bacterial viability during stress conditions. It functions as a phosphatase specific

Ngày tải lên: 18/02/2014, 14:20

... than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal or pre-operative consultation, and resident training) In ... cesareans are the predominant determinants of obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean Accordingly, the OAAI for each hospital was ... anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery The OAAI is a formula composite comprising data

Ngày tải lên: 05/03/2014, 15:20

... Annals of Mathematics On a vanishing conjecture appearing in the geometric Langlands correspondence By D Gaitsgory Annals of Mathematics, 160 (2004), 617–682 On a vanishing conjecture appearing ... representation with m > n, has an analytic continuation and satisfies a functional equation More precisely, let X be a curve over a finite field, and K the corresponding global field Then it is known that ... sequel, the vanishing of the functor Avd E is analogous to the condition that the Rankin-Selberg convolution of E, viewed as an m-dimensional Galois representation, and an automorphic form on GLn with

Ngày tải lên: 05/03/2014, 23:20