... psychotherapy, too Jack had made a long and arduous trip to India wanting meditationtraining, but Munindra did not play directly into his agenda To my mind, he wanted Jack to have a bigger picture ... Westerners to ordain as a Buddhist monk in the school of Tibetan Buddhism headed by the Dalai Lama And Sharon Salzberg is a meditation teacher in thevipassana tradition of Theravada Buddhism, ... wecannot handle and soldier on as if we are not as fragile as we actually are But the Buddha was like a contemporary behaviorist who teaches people to carefully go toward the things they fear...
Ngày tải lên: 22/04/2019, 14:18
... communi-cation and negotiation, as well as the need to be able to react quickly todisturbances and to change tactics at short notice, are of greatest impor-tance Moreover, an ad hoc approach balances ... introduced a scientific-managementapproach to production department work; and Peter Drucker can be cat-egorised as a classical administrator, at least in his approach to strategydevelopment and decision-making.The ... Deci-sion-making had been flawed and was incapable of understandingwhat actually happens in organisations, leaving them poorly placed toface the challenge of change Mintzberg advocated the need to prescribethrough...
Ngày tải lên: 28/06/2014, 22:20
business strategy a guide to effective decision making phần 1 pptx
... information and using it in a flexible way to improve efficiency, generate profitable new ideas and, overall, add value... and valuable are now able to exert a massive amount of power and ... to quantify and value intellectual capital was Leif Edvinsson Appointed in 19 91 as the world’s first director of intellectual capital at Skandia, Sweden’s largest financial services corporation, ... theory at least, to relate individually to every single customer The classic pioneers of this approach are the online bookseller or travel agent: with the mass appeal of a major retailer,...
Ngày tải lên: 10/08/2014, 07:20
business strategy a guide to effective decision making phần 2 potx
... helps to have an understanding of theories of management and leadership that have emerged during the past century. Decision-making approaches The classical administrator The classical administrator ... learnt about the role and application of technology, but more remains to be learnt about what it can do and, in particular, how to use it. As Marchand says: Information can be used to develop and ... to build shareholder value and to keep ahead... competitors? What type of organisation should it be? What are the brand values and aspirations of the organisation, and what do they need to...
Ngày tải lên: 10/08/2014, 07:20
business strategy a guide to effective decision making phần 3 docx
... Do you apply a range of approaches (such as classical, visionary,competitive) to strategic decision-making? Is your approach todecision-making versatile and appropriate in various circumstances? ... informa-tion; a lack of analysis; a feeling that the truth needs to be concealed, or fram-a fefram-ar of revefram-aling it; or fram-a desire to show expertise A simpler cfram-ause mfram-ay be lack of ... common to all of the company’s woes was a failure to respond to thefast-changing retail market Marks & Spencer was established in the late 19th century by Michael Marks, aRussian immigrant, and...
Ngày tải lên: 10/08/2014, 07:20
business strategy a guide to effective decision making phần 4 potx
... is a chance to motivate and encourage, as well as an opportunity to see whereadjustments will or may be necessary as circumstances change A tech-nique that can help to manage information and ... Company: “Balanced emotions are crucial tointuitive decision-making.” Many difficulties, such as overconfidence,can be traced back to a flawed, unbalanced application of either therational or ... business areas such as marketing, public relations and communi-cation, managing people and researching Areas such as planning, pro-cess management and finance are harder business functions that benefitfrom...
Ngày tải lên: 10/08/2014, 07:20
business strategy a guide to effective decision making phần 6 pot
... redefining and focusing on core operations Themain advantages are a clear focus and strength in depth, with all avail-able resources channelled into one endeavour It also means that anycash available ... thebirthplace of Coca-Cola, consumers reacted angrily and emotionally to the newformula Thousands contacted the organisation’s headquarters in Atlanta Remarkably, many were not Coca-Cola drinkers, ... (particularly financial) andaerospace, could be exploited Daimler-Benz and Chrysler were keen to enhancetheir financial standing, broaden their access to intellectual capital and increasetheir strategic...
Ngày tải lên: 10/08/2014, 07:20
business strategy a guide to effective decision making phần 10 doc
... strength and advantage. Behaviours to avoid in decision-making include procrastination or panic. Instead, adopting a calm, positive and appropriate approach that displays the right qualities at the ... 115 Apollo 115 Apter, Michael 79 Argentina 19 Asia 8–9, 20, 223 demographics 24 diaspora 19 international expansion 96 regulation 26 average cost pricing 188 Page 235 awareness raising 60 B balanced ... Review, March 2001 8 Hamilton, S., “Information and the Management of Risk”, in Marchand, D .A (ed.), Competing with Information: A Manager’s Guide to Creating... Non-Financial Manager, HarperCollins,...
Ngày tải lên: 10/08/2014, 07:20
the videomaker guide to digital video and dvd production
... general, the main differences between standard and high grades of analog camcorders are image and audio quality High grade formats noticeably increase image resolution and audio fidelity over standard ... twice as fast as in its analog relatives, and the signal is digital The Digital8 format is backward-compatible with the analog mm format That’s a big plus if you have a closetful of legacy mm gear ... permanent damage to the camera or personal harm to you We recommend that you always (and only) have your video camera repaired by a trained professional 21 All About Lenses Jim Stinson Without passing...
Ngày tải lên: 01/06/2014, 11:26
ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU
... Primer name Sequence (5'→3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 3 0A CCCCTATCCTTTCCGCGTCCTTACTTCCCC 30C GGGGAAGTAAGGACGCGGAAAGGATAGGGG 12 Following incubation, virus ... uses a carboxyl and amine-reactive small molecule, EDC, as a catalyst to react with a carboxyl group first that then forms an unstable intermediate that reacts with a primary amine to form an amide ... A catalyst is used to activate the side chain of a specific amino acid that then forms an intermediate This intermediate then acts as a nucleophile and attacks the side chain of an adjacent amino...
Ngày tải lên: 24/08/2014, 11:02
Báo cáo y học: "Genetic polymorphisms in the nucleotide excision repair pathway and lung cancer risk: A meta-analysis"
... activated carcinogens can bind to DNA and form DNA adducts that are capable of inducing mutations and initiating carcinogenesis The capacity to repair DNA damage induced by activated carcinogens 61 appears ... Tanaka K, Miura N, Satokata I, et al Analysis of a human DNA excision repair gene involved in group A xeroderma pigmentosum and containing a zinc-finger domain Nature 1990; 348: 73-6 65 Sarasin ... a meta-analysis The idea of adjusting the results of meta-analyses for publication bias and imputing "fictional" studies into a meta-analysis is controversial at the moment [34] Sutton et al concluded...
Ngày tải lên: 31/10/2012, 14:59
Analysis of Phosphorus Behavior in the Giant Reed for Phytoremediation and the Biomass Production System
... reagent The phosphorus accumulation was assumed to be uniform in all the leaves, and the total amount of the accumulation was evaluated from the total leaf area During the measurements, plants ... seasonal variation of phosphorus uptake by an ideal one-dimensional giant reed cultivated waterway (Fig 7) In this simulation, the loading phosphorus concentration and water loading rate were assumed ... Cultivated Waterway based on Estimated Imax and Km (phosphorus concentration in loading water = 2.5 mg-P/L; water loading rate = 0.6 m/day) Phosphorus Accumulation and Translocation in the Giant...
Ngày tải lên: 05/09/2013, 09:38
Picture of the victorian society in the two novels oliver twist and vanity fair = bức tranh xã hội anh thời kì victoria qua hai tác phẩm ôlivơ tuyxt và hội chợ phù hoa
... Calcutta, India, as the only son of Richmond Thackeray After his father death, and his mother’s remarriage with Major Henry Carmichael Smyth, Thackeray was sent to England and educated at Charterhouse ... Oliver was starved and exhausted He met Jack Dawkins who was at Oliver’s age Jack took Oliver to the house of his benefactor, Fagin It turned out that Fagin was a professional criminal who trained ... determination, intelligence, hard work and talent She is an unscrupulous trickster, a liar, a cheat, a schemer, manipulator, a gambler, a hypocrite, a betraying wife and friend, and a callous...
Ngày tải lên: 19/12/2013, 14:05
Tài liệu Báo cáo Y học: Induction of (2¢)5¢)oligoadenylate synthetase in the marine sponges Suberites domuncula and Geodia cydonium by the bacterial endotoxin lipopolysaccharide docx
... and AMP (The SD is less than 15%; n ¼ 5) LPS (lgÆmL)1) Animals S domuncula tissue Sea Aquarium Aquarium Aquarium Aquarium Aquarium Aquarium Aquarium S domuncula primmorphs Aquarium Aquarium Aquarium ... and methods Lane a: S domuncula (aquarium animal); lane b: S domuncula (sea animal); lane c: G cydonium (sea animal) Lane a and b: mg of total protein per assay, synthesis time 12 h; lane c: mg ... melanogaster (Advanced BLAST available from http:// www.ncbi.nlm.nih.gov/blast/blast.cgi); a related enzyme is also lacking in yeasts (e.g Saccharomyces cerevisiae) or plants (Arabidopsis thaliana)...
Ngày tải lên: 21/02/2014, 15:20
THE REPRODUCTION OF LABOR-POWER IN THE GLOBAL ECONOMY, MARXIST THEORY AND THE UNFINISHED FEMINIST REVOLUTION ppt
... bureaucratization of life imposed by the socialist and welfare states has been a set back It is an expression of capital’s power to refuse all social contract, to de facto abrogate all contractual relations, ... Negri maintain it has reconstructed it as a pyramidal structure, increasing inequality and polarization, and deepening the hierarchies that have historically characterized the sexual and international ... necessities all have been slashed, axed, gutted As a consequence, life expectancy is falling and phenomena have reappeared that capitalism was supposed to have erased from the face of the earth long ago:...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo khoa học: Use of lithium and SB-415286 to explore the role of glycogen synthase kinase-3 in the regulation of glucose transport and glycogen synthase pdf
... activity as described earlier Statistical analyses For multiple comparisons statistical analysis was performed using one-way analysis of variance (ANOVA) followed by a Newman–Keuls post-test Data analysis ... pathways Am J Physiol 36, E28–E36 Kaburagi, Y., Satoh, S., Tamemoto, H., Yamamoto-Honda, R., Tobe, K., Veki, K., Yamauchi, T., Kono-Sugita, E., Sekihara, H., Aizawa, S., Cushman, S.W., Akanuma, ... phospho-specific antibodies against PKB and GSK 3a/ b As a loading control, lysates were immunoblotted with an antibody to native PKBa The blots are representative from up to three separate experiments Alternatively...
Ngày tải lên: 08/03/2014, 08:20
Philosophy in a New Key A Study in the Symbolism of Reason, Rite, and Art
... a theory that bridges what used to appear as a saltus naturae, a logical explanation displacing a shamefaced resort to miracle, has so much to recommend it that one hates to challenge it on any ... a mistaken view of causality After all, a savage who beats a tom-tom to drive off his brother's malaria would never make such a practical mistake as to shoot his arrow blunt end forward or bait ... supposed to be the abundance of their strength after their needs are satisfied Yet artists as a class are so ready to sacrifice wealth and comfort and even health to their trade, that a lean and hollow...
Ngày tải lên: 14/03/2014, 17:25
Volatile Organic Compounds in the Nation’s Ground Water and Drinking-Water Supply Wells pdf
... this type of contamination can spread over a large area Contamination also can originate over large areas from sources such as leaking water and sewer lines, stormwater runoff, and atmos- pheric ... due to a lack of toxicity information Measured contaminant concentrations may be compared to HBSLs to evaluate water-quality data in a humanhealth context Such comparisons can provide an early ... necessarily an exact measure of a VOC source that is contributing a VOC to ground water Although preferable in this analysis, national data sets of releases for all VOC groups are not available Additionally,...
Ngày tải lên: 14/03/2014, 19:20
Báo cáo khoa học: Delineation of the roles of FadD22, FadD26 and FadD29 in the biosynthesis of phthiocerol dimycocerosates and related compounds in Mycobacterium tuberculosis pptx
... fadD22C TCACGGGTCGCATCAAGGAGC fadD22J ACAACATATGCGGAATGGGAATCTAGC fadD22K ACAAAAGCTTCTTCCCAAGTTCGGAATCGA fadD26F CATAGTGAACGCCAGAAAGCCG fadD26G TAGGTAGTCGATTAGCCAGTGG fadD26K ACAACATATGCCGGTGACCGACCGTT ... CCGACTCGGATTCGTATGAAAG fadD29F GTTATGCCATAGCATCTAGGC fadD29I ACTTCGCAATGAAAACCAACTCGTCATTTC 2949H ACTTCGCAATGACCGAGTGTTTTCTATCTG 2949I ACAAAAGCTTTATTGGATGACCGCCCTAG res1 GCTCTAGAGCAACCGTCCGAAATATTATAAA ... ACAACATATGCCGGTGACCGACCGTT fadD26L ACAAAAGCTTCATACGGCTACGTCCAGCC fadD2 9A GCTCTAGAGTTTAAACCGCGCTCGGGGTACCTGG fadD29B GCGCGGCCGCGTTTAAACCGATCGCGCAGCGCATC fadD29C TCGCGACGACGTGGAAGAGGC fadD29D ATCGGTTCGTAGCCTCCAGGC fadD29E...
Ngày tải lên: 15/03/2014, 11:20
PHYSICAL TECHNIQUES IN THE STUDY OF ART, ARCHAEOLOGY AND CULTURAL HERITAGE VOLUME 1 pdf
... heritage artefacts and keep them available, in as satisfactory a condition as possible for future generations is a very significant challenge For the examination, characterisation, and analysis ... dedicated to cultural heritage artefacts analysis AGLAE (Accộlộrateur Grand Louvre pour lAnalyse Elộmentaire) is a National Electrostatics Corp tandem accelerator (2 MV) Figure shows the end-stations ... He has been a researcher at the ENEA (the Italian nuclear authority) and was the Director of a Research Centre with two experimental reactors He was also an Expert of the United Nations (IAEA)...
Ngày tải lên: 22/03/2014, 09:20