mousepox a small animal model of smallpox

... effective as the investment o f the companies 1 The Cronbach alpha and EFA results posed no matters for concerns and are available upon request. Trang 5Nguyen: A New Application Model of Lean Management ... 11 VARVisuall Independent, visualization of strategy The variable “ z ” is computed by the arithmetic average of VARVisual 1 to VARVisual5 12 VARVisual2 Independent, visualization of operation ... New Application Model of Lean Management in Small and Medium Sized .Table III: Forecasted values of Y\. Standard Deviation 2.10 Coeff of Variability 0.3842 Mean Std Error 0.02 The proposed model

Ngày tải lên: 16/12/2017, 10:59

... in a way that makes those states-of-affairs that are in it aligned with the metaphor, whereas all other states are left out of the proposed metaphorical frame As the game proceeds, the public attention ... advances the understanding of the process be-ing modeled, and hence of the applicability, and the potential adaptation, of statistical models de-veloped on a certain dataset to situations that ... sub-strategy is that part of the original strategy that is a strategy on the subgame A pair of strategies is a subgame per-fect equilibrium if, for any subgame, their sub-strategies are a Nash equilibrium

Ngày tải lên: 30/03/2014, 21:20

... lack of suitable animal models that exhibit fea-tures of human disease Genetically manipulable mam-malian models of spontaneous ovarian cancer are rare, particularly those representing ovarian ... TgMISIIR-TAg ovaries, fallopian tubes and bursa 6/8 Trang 10disseminated peritoneal adenocarcinoma infiltrating thepancreas, omentum, mesentery, diaphragm and abdom-inal wall, histopathological review ... inhibition of PP2A, SV40 tag also results in activation of PI3K/AKT and mitogen activated protein kinase (MAPK) signaling [42], pathways fre-quently activated in human EOC [43] A stable trans-genic

Ngày tải lên: 20/06/2014, 07:20

... ) Assume that the average growth rates in (1.2) change at equally spaced time intervals and estimates of the population size are made at equally spaced time intervals, then we can incorporate ... Trang 1MODEL OF PLANKTON ALLELOPATHYJIANBAO ZHANG AND HUI FANG Received 19 May 2005; Revised 25 September 2005; Accepted 27 September 2005 We study a discrete time model of the growth of two ... following preparations LetX and Y be normed vector spaces Let L : Dom L ⊂ X → Y be a linear mapping and N : X → Y be a continuous mapping The mapping L will be called a Fredholm mapping of index zero

Ngày tải lên: 22/06/2014, 22:20

... slightly affects the amplitudes of the harmonics In par-ticular, at high values ofΨ, a small increase in Ψ results in a strong decrease in the pitch A cancellation of the self-oscillation process can ... lengthL1, radiusR1, sur-face S1, and characteristic impedance Z1 This is the backbore to which the reeds are attached Its radius is small in comparison with that of the main conical bore, the characteristic ... impedance peaks in the combination backbore/conical bore The impedanceC1(ω) of the short cylindrical backbore is based on an approximation of i tan(k1(ω)L1) with small values ofk1(ω)L1 It takes

Ngày tải lên: 23/06/2014, 01:20

... cis-platinum, UV irradiation or heat Curr Biol 1996, 6:606-613. 29 Pandey P, Avraham S, Place A, Kumar V, Majumder PK, Cheng K, Nakazawa A, Saxena S, Kharbanda S: Bcl-xL blocks activation of related ... Sequence-dependency of radiation and AT-101 Radiation (6 Gy) and AT-101 (1 μM) were either applied concurrently (hatched bars) or sequentially (AT-101 24 h after radiation; black bars) Apoptosis was analyzed at ... Gossypol and radiation activate the SAPK/JNK pathway A: AT-101 is a stronger activator of SAPK/JNK than racemic (±)-gossypol U937 cells were treated with equimolar concentrations of AT-101 (5 μM) and

Ngày tải lên: 09/08/2014, 10:20

... magnification images of sagittal sections of articular cartilage, stained with safranin-O and fast-green, reveal detailed cartilage histology High magnification images of sagittal sections of ... tube has a tungsten target with a Figure 1 Forced mobilization apparatus and macroscopic analysis of joint degradation Forced mobilization apparatus and macroscopic analysis of joint degra-dation ... joints macroscopically, 4 weeks after surgery A healthy articular surface was observed in all sham animals, whereas in model animals ipsilateral joint sur-faces were abraded and contained fibrotic

Ngày tải lên: 09/08/2014, 10:20

... Therefore, the application of the AM approach may be limited to smaller data sets Accordingly, Cantet and Smith (1991) derived a reduced animal model (RAM) version of Fernando and Grossman’s approach, ... can be obtained according to equation !14!. EXAMPLE We use a small example data set including six animals, four animals having progeny and two animals with no progeny, as given in table I We assume ... corresponding to animal i of K can be computed as where A p, A u p and A p are appropriate submatrices of A , A and A , respec-tively, tis the vector corresponding to animal i of T, qis the matrix corresponding

Ngày tải lên: 09/08/2014, 18:22

... data and found that some network hubs have existing functional evidence in Arabidopsis; Quesada et al [14] performed a comparative analysis of the transcriptomes of Populus and Arabidopsis, and ... generated adequate quanti-ties of high-quality data to enable systems analysis [6] For example, Carerra et al [4] modeled the transcrip-tional network of Arabidopsis and identified plant-specific properties ... factors, we have plotted the T-statistics of the b’s rather than their actual values Statistically significant values are marked by dotted lines. Figure 7 Bootstrap analyses of the network (A)

Ngày tải lên: 11/08/2014, 11:21

... Biosciences; San Jose, CA, USA) Samples were acquired on a FACSCalibur flow cytometer (BD Biosciences) and analyzed using FloJo software (Tree Star, Ashland, OR, USA) Statistical analysis Data was collected ... Autoantibody analysis using enzyme-linked immunosorbant assay (ELISA) Serum and plasma samples were collected from each mouse at euthanasia An ELISA kit was used to test rela-tive levels of total IgG antibodies ... School of Medicine, University of California, 1000 Veteran Avenue, Los Angeles, CA 90095, USA Full list of author information is available at the end of the article Trang 2Studies of the pathogenesis

Ngày tải lên: 12/08/2014, 12:20

... Trattamento dei Neurolesi Lungodegenti, University of Messina, Messina, Italy and 4 Department of Clinical and Experimental Medicine and Pharmacology, Catania, Italy Email: Marco Failla - marcofailla@yahoo.it; ... Medicine, Section of Respiratory Diseases, University of Catania, Catania, Italy, 2 Department of Clinical and Experimental Medicine and Pharmacology, University of Messina, Messina, Italy, 3 Centro ... confirmed using a pharmacological approach, so that no data exist actually on the efficacy of selective drugs targeted on the leukotrienes pathway approved today for human use This lack of data prompted

Ngày tải lên: 12/08/2014, 16:20

... intra-articular injection Abbreviations ANOVA: analysis of variation; AUC: area under the curve; HA: hyaluronic acid; MT: mechanical threshold; NASHA: stabilized hyaluronic acid from a non-animal ... between NASHA and Hylan GF20 as well as between NASHA and sodium hyaluronate Data are presented as mean ± standard error of the mean (a and c) + comparison between NASHA and Hylan GF20 * comparison ... efficacy of the lower doses Data are presented as mean ± standard error of the mean + comparison between NASHA 10 and NASHA 100; * comparison between NASHA 10 and NASHA 50; § comparison between NASHA

Ngày tải lên: 12/08/2014, 17:22

... values of renal venous pressure were not available, an estimation of the vascular resistance of the renal artery flow region was made: MAP – RBF ratio (U) = (MAP/RBF) × 100 [31] Assessment of ... by an increased heart rate, a slight reduction in MAP, a marked decline in RBF, an increase in renal vascular resistance, and a reduction in the glomerular filtration rate resulting in anuria As ... of the Academic Medical Center at the University of Amsterdam Care and handling of the animals were in accordance with the guidelines for Institu-tional and Animal Care and Use Committees Experiments

Ngày tải lên: 12/08/2014, 23:24

... (fiona.wightman@monash.edu)Saumya Ramanayake (saumya1025@gmail.com)Marina Alexander (marina.r.alexander@gmail.com)Nitasha Kumar (nakum1@student.monash.edu)Gabriela Khoury (gabriela.khoury@monash.edu)Candida Pereira ... CCL19-induced HIV latency, we next examined expression of US and MS RNA (location of primers are summarised in Figure 3A) The mean fold increase of US RNA (expression at day 4 compared to day Trang 90) ... DNA ratio was 0.25 and 0.08 for PHA/IL-2 activated and CCL19-treated infected CD4+ T-cells respectively (n=5) The mean copy number of MS RNA in IL-2/PHA activated, CCL19-treated and unactivated

Ngày tải lên: 13/08/2014, 01:21

... reaction rates of the receptor-toxin-antibody kinetics and the relative concentration of reacting species [6] As a result, any given value of this parameter determines an associated range of antibody ... kinetics and the relative concentration of reacting species As a result, any given value of this parameter determines an associated range of antibody kinetic properties and its relative concentration ... Trang 1R E S E A R C H Open AccessA reaction-diffusion model of the receptor-toxin-antibody interaction Vladas Skakauskas1, Pranas Katauskis1and Alex Skvortsov2* * Correspondence: alex. skvortsov@dsto.defence.gov.au

Ngày tải lên: 13/08/2014, 16:20

... size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innotech, San Leandro, CA, USA) The area was calculated in relation with that ... by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and ... immediate reimplantation of resected bone J Craniomaxillofac Surg 1991, 19:31-39 Ehara S, Nishida J, Shiraishi H, Tamakawa Y: Pasteurized intercalary autogenous bone graft: radiographic and scintigraphic...

Ngày tải lên: 20/06/2014, 04:20

... CCGCTATGACGCCATCTGCT R TGCACGACGAGGTCCTCACT AF019758 Decorin 55 319 F CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 ... F CTGGACCACAACAACCTGAC R GGATCTTCTGCAGCTGGTTG AF020291 Lumican 65 284 F CAGCCATGTACTGCGATGAG R CTGCAGGTCCACCAGAGATT NM173934 TGF-β 60 271 F CGGCAGCTGTACATTGACTT R AGCGCACGATCATGTTGGAC AF000133 ... TCTTCTGCGACTTCGGCTCC R CCTCCAGGTCAGCTTCGCAA NM174030 Collagen I 65 460 F CCACCAGTCACCTGCGTACA R GGAGACCACGAGGACCAGAA AF129287 Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTG R GTGGGGAAACTGCACAACAT L47641...

Ngày tải lên: 09/08/2014, 06:23

... 5'-GCCTCCAGCATGAAAGTCTC, 3'-TAAAACAGGGTGTCTGGGGA), IL-1β (5'-TGCACGATGCACCTGTACGA, 3'-AGGCCCAAGGCCACAGGTAT), IL-6 (5'-GTTCCTGCAGAAAAAGGCAAAG, 3'-CTGAGGTGCCCATGCTACATTT), matrix metalloproteinase (MMP)-3 ... (5'-GTCCTCTCCCAAGTCCACACA, 3'-CTGGTCTCAAGTCAGTGTACAGGTAA), CC chemokine ligand (CCL)5 (formerly called RANTES; 5'-CGCTGTCATCCTCATTGCTA, 3'-GCTGTCTCGAACTCCTGACC), CCL2 (formerly called MCP-1; 5'-GCCTCCAGCATGAAAGTCTC, ... A, Ghosh S: Amelioration of acute inflammation by systemic administration of a cell-permeable peptide inhibitor of NF-κB activation Arthritis Rheum 2005, 52:951-958 20 Ariga A, Namekawa J, Matsumoto...

Ngày tải lên: 09/08/2014, 07:20

... rows and columns pertaining to this are EXAMPLE Six animals (animals 1-6) are considered for an illustration Marker information on the animals is given in figure Animal has no record, and animals ... expectation and dispersion parameters of up, vp and 4) are where the matrices respectively, and p u A and A, , are u v appropriate submatrices of A and A D is a diagonal matrix with diagonal elements, ... evaluations in which only a small fraction of the animals are genotyped for ML and the remaining fraction not provide marker data, Hoeschele’s (1993) procedure can have the large advantage of...

Ngày tải lên: 09/08/2014, 18:22

... similar parameterization (Ovc to obtain and B The conditional densities for the FAM are a special case of RAM (see ) RT table I ): all animals are in category and wz In case of O the conditional ... markers and quantitative trait loci for a granddaughter design, J Dairy Sci (1997) [28] VanRaden P.M., Wiggans G.R., Derivation, calculation and use of national animal model information, J Dairy ... is an advantageous property in Bayesian analysis !16! In this paper, we present MCMC algorithms that allow Bayesian linkage analysis with a RAM We study two alternative parameterizations of the...

Ngày tải lên: 09/08/2014, 18:22