modifying data using a strongly typed dataset

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

Báo cáo khoa hoc:" Estimating covariance functions for longitudinal data using a random regression model" potx

... traits, i.e carrying out a q-dimensional, multivariate analysis, or fitting the so-called repeatability model, i.e assuming a = a and r = for all j = 1, , q and carrying out a univariate analysis ... and a total of q different ages in the data. Commonly, under a ’finite-dimensional’ model of analysis, data represented by equation (2) are analysed either assuming measures at different ages are ... multivariate analysis [15] As the name indicates, a covariance function (CF) describes the covariance between records taken at certain ages as a function of these ages A suitable function is a higher

Ngày tải lên: 09/08/2014, 18:21

20 218 0
Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

Báo cáo sinh học: " The analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication)" ppt

... simulation was replicated 10 times Simu-lated rather than real data were used because a negative diagnosis, even based on the absence of bacteria in cell culture, is not a guarantee of health and ... values was computed for each replicate and aver-aged over the 10 replicates For residual and additive variances, the differences (biasr0, biasr1, and biasra) between estimates and simulated values ... Trang 1Original articleThe analysis of disease biomarker data using a mixed hidden Markov model (Open Access publication) Johann C DETILLEUX* Quantitative Genetics Group, Department of Animal

Ngày tải lên: 14/08/2014, 13:21

19 390 0
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx

... ambient air pollutants display significant small-scale spatial variation This intra-urban spatial variation has been documented especially for traffic-related pollu-tants such as NO2, black smoke, ... standards at locations near heavy traffic Furthermore, PM and NO can be regarded as Trang 7markers for the traffic-related air pollution mixture andhave been associated with several adverse health ... Particulate matter air pollution and cardiovascular disease: An update to the scientific statement from the American Heart Association Circulation 2010, 121:2331-2378. 3 Kampa M, Castanas E: Human health

Ngày tải lên: 06/03/2014, 19:20

11 514 0
Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

Báo cáo y học: " The prevalence of common mental disorders and PTSD in the UK military: using data from a clinical interview-based study" pdf

... et al (2007) b Mean age; percentage for all other variables c UK data weighted to take account of sampling weights d Demographic data are not separately available for those on active duty and ... sample The comparisons that we make with US data are limited in several ways First, although the data relate to the same Iraq deployment, they were collected in different ways The PDHRA data ... those who are National Guard or reserves; data are shown are for US or UK personnel overall e Data on combat experiences colleted at phase 1 for the UK study (i.e combat experiences data collected

Ngày tải lên: 11/08/2014, 17:20

12 475 0
báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

báo cáo khoa học: " Detection and validation of single feature polymorphisms using RNA expression data from a rice genome array" pot

... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA ... AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA AAATTCAACTCGGAAGAACTCTTCTAACACTTAATCGTTTGTCAATCCCTGAGCCACTGAGGTACTAGGAAGGAAACAAATGA 2 I F P S : 83 : 83 : 83 : 83 2 CATACTGGTAAAGCTTTTATTGTTTTCTATCATTATAATAGCTCTTTTTCTTTTTTGCTTATTCTTTGGTCTGATTCTTTGGA ... GAGACAAATGTTTTCCAT G ATAGCA GAGACAAATGTTTTCCAT A ATAGCA GAGACAAATGTTTTCCATGATAGCA I F P S Os.55011.1.S1_x_at (LOC_Os01g20120) A -AACCGGATTTGTTAACAAG A -AACCGGATTTGTTAACAAG A -AACCGGATTTGTTAACAAG AGTACTACACGGATTTGTTAACAAG

Ngày tải lên: 12/08/2014, 03:20

10 252 0
Báo cáo sinh học: "Analysis of a simulated microarray dataset: Comparison of methods for data normalisation and detection of differential expression (Open Access publication)" pps

Báo cáo sinh học: "Analysis of a simulated microarray dataset: Comparison of methods for data normalisation and detection of differential expression (Open Access publication)" pps

... ensured that the variance in M values was consistent across arrays Data normalisation of gene expression analysis 675 Table II Summary of the 12 methods used for analysing the simulated data “Analysis ... INRA, EDP Sciences, 2007 DOI: 10.1051/gse:2007031 Available online at: www.gse-journal.org Original article Analysis of a simulated microarray dataset: Comparison of methods for data normalisation ... M values (log2 (cy5/cy3)) across the 10 arrays for three normalisation strategies: (A) Unnormalised data, (B) LOESS normalised data, and (C) LOESS followed by scale normalised data column and

Ngày tải lên: 14/08/2014, 13:22

15 266 0
Automated software test data generation using a genetic algorithm

Automated software test data generation using a genetic algorithm

... the new approach in next section briefly and use it to solve Fig 1 sample program 3 Test data generation and Software testing using a GA Outline of test data generation using a GA Test data problem ... the declaration part of the dynamic data structure, it is assumed that input data structure is a directed graph The approach to find an input data structure would be to search the space of all input ... paper we pro-posed a new approach automated test data generation using a genetic algorithm (GA) Com-pared with traditional search algorithms the efficiency and efficacy are much better than

Ngày tải lên: 08/11/2017, 23:49

15 186 0
Getting started with greenplum for big data analytics  a hands on guide on how to execute an analytics project from conceptualization to operationalization using greenplum

Getting started with greenplum for big data analytics a hands on guide on how to execute an analytics project from conceptualization to operationalization using greenplum

... Typically, data stored in a relational database can be categorized as structured data Data that is represented in a strict format is called structured data Structured data is organized in semantic ... High-speed data loading using external tables 50 Polymorphic data storage and historic data management 51 Greenplum Data Integration Accelerator (DIA) 58 Chapter 3: Advanced Analytics – Paradigms, ... character data: • Configuration data: This classification refers to the data that describes data or defines the way data needs to be used There can be many categories of configuration data For

Ngày tải lên: 04/03/2019, 14:12

172 86 0
The suppressive role of miR-542-5p in NSCLC: The evidence from clinical data and in vivo validation using a chick chorioallantoic membrane model

The suppressive role of miR-542-5p in NSCLC: The evidence from clinical data and in vivo validation using a chick chorioallantoic membrane model

... most malignan-cies, the patients with NSCLC who received diagno-ses at an early stage achieved higher five-year survival rates, compared to patients whose diagnoses were made at an advanced stage ... Vascular invasion EGFR protein b n The number of patients * p < 0.05 a The data were available from 68 patients b The data were available from 57 patients Trang 3until the manuscript deadline; ... involving ani-mals and their care complied with the China Na-tional Institutes of Healthy Guidelines for the Care and Use of Laboratory Animals Ethical approval for the study was granted by the Ethical

Ngày tải lên: 06/08/2020, 04:09

15 11 0
A study on fast calling variants from nextgeneration sequencing data using decision tree

A study on fast calling variants from nextgeneration sequencing data using decision tree

... with a well-balanced performance with regard to accuracy and recall, making it a good choice for exome-capture data analysis Calling variants from low-coverage sequencing data Low-coverage data ... built, all candidate variants in each leaf node are assigned a new qual value, which is the mean qual of all candidate variants in that leaf node Candidates with a qual higher than the threshold are ... into a hash table so that any searching can be finished in a constant time After this step, all candidate variants are obtained and labelled To date, most common human variants have already been

Ngày tải lên: 25/11/2020, 15:40

14 7 0
Using a project based-learning method in each advanced data structures – priority queues

Using a project based-learning method in each advanced data structures – priority queues

... lists, Trang 5SPEEDESQ and Ladder Queue.- To design Java applet simulations and some simple applications, for example, heap sort, a container, a searchable container, Dijkstra algorithm, graph algorithms ... Binary heap, Fibonacci heap, Trinomial heap, Binomial heap, Relaxed heap, 2-3 heap, Skew heap, Van Emde Boas tree, Sorted linked list, Splay tree, Calendar queue, Lazy queue, Henriksen’s data ... example, Pascal, C, C++ or Java) and algorithm analysis techniques (worst-case, best-case, average-case, amortized analysis) Information Sources: References: Introduction to algorithms [7], Van

Ngày tải lên: 25/11/2020, 23:27

10 28 0
Lecture Data structures and other objects using C++ - Chapter 7: Using a stack - Trường Đại học Công nghiệp Thực phẩm Tp. Hồ Chí Minh

Lecture Data structures and other objects using C++ - Chapter 7: Using a stack - Trường Đại học Công nghiệp Thực phẩm Tp. Hồ Chí Minh

... N­Queens problem Data Structures and Other Objects Using C++ Trang 2chess queens and a chess board Trang 3placed on the board so  that no two queens are  attacking each other   ? Trang 4allowed in the same  ... Trang 1Chapter 7 introduces the  stack data type Several example  applications of stacks are  given in that chapter.  This presentation shows  another use called  backtracking to solve the  ... row Trang 5allowed in the same   row, or in the same  column Trang 6allowed in the same   row, or in the same  column, or along the  same diagonal Trang 7and the size of the board  can vary ws

Ngày tải lên: 01/04/2021, 18:34

10 1 0
Identifying a time dependent zeroth order coefficient in a time fractional diffusion wave equation by using the measured data at a boundary point 2

Identifying a time dependent zeroth order coefficient in a time fractional diffusion wave equation by using the measured data at a boundary point 2

... Trang 1Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=gapa20Applicable Analysis An International Journal ISSN: ... by using the measured data at a boundary point School of Mathematics and Statistics, Lanzhou University, Lanzhou, People’s Republic of China ABSTRACT In this paper, we investigate a nonlinear ... Journal homepage: https://www.tandfonline.com/loi/gapa20 Identifying a time-dependent zeroth-order coefficient in a time-fractional diffusion-wave equation by using the measured data at a boundary

Ngày tải lên: 10/10/2022, 07:10

27 1 0
Using a gridded global data set to characterize regional hydroclimate in central Chile

Using a gridded global data set to characterize regional hydroclimate in central Chile

... dataset is based on the NCEP–NCAR reanalysis [Kalnay et al., 1996] for 1948-2008, from which daily maximum and minimum temperature and daily precipitation are obtained at approximately 2º spatial ... Trang 14Figure 7 shows that the probabilities of a day being wet or dry are comparable between bothdatasets (panels 7a and 7b) Conversely the adjusted precipitation data shows an averagetransition ... to other relatively data-sparseregions, where representative climatological average information is available but long-term dailydata are inadequate The paper is organized as follows: Section

Ngày tải lên: 18/10/2022, 01:45

44 3 0
Behaviour analysis using tweet data and geo tag data in a natural disaster

Behaviour analysis using tweet data and geo tag data in a natural disaster

... using tweet data and geo-tag data in a natural disaster a Graduate School of Information Sciences, Tohoku University, 6-6-06, Aoba, Aramaki, Aoba-ku, Sendai, Japan Abstract This paper clarifies ... behavioural factors We clarify the factors associated with return-home behaviour in the case of the Great East Japan Earthquake using Twitter data Trang 32 From tweet data to behaviour data 2.1 Framework ... human behaviour but also human behaviour at the time of a disaster itself In this paper, we analyse tweet data from Twitter as the behaviour log data at the time of the Great East Japan Earthquake

Ngày tải lên: 19/11/2022, 11:46

14 3 0
Validating-Accelerometry-Estimates-Of-Energy-Expenditure-Across-Behaviours-Using-Heart-Rate-Data-In-A-Free-Living-Seabird.pdf

Validating-Accelerometry-Estimates-Of-Energy-Expenditure-Across-Behaviours-Using-Heart-Rate-Data-In-A-Free-Living-Seabird.pdf

... give an overall value for dynamic acceleration experienced rate and ODBA using calibrations conducted in the laboratory on a congeneric species of seabird, the great cormorant Phalacrocorax carbo ... walking and diving during heart rate calibrations and walking and averaged across each behavioural period per individual, defined as a period of any length of one of the three behavioural states ... and ODBA across a number of taxa in controlled conditions (Halsey et al., 2008; Halsey et al., 2009) Additionally, accelerometer data can provide high resolution behavioural information (Yoda

Ngày tải lên: 15/03/2023, 20:37

33 3 0
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

... ofManagement EvaluationofInformation StrategyEvaluation StrategySelection StrategyImplementation ExternalAnalysis InternalAnalysis FIGURE 2–1. Basic strategic planning Strategic Market Plan Shared ... critical success factors: qualitative factors, or-ganizational factors, and quantitative factors To take advantage of the economicoutlook, whatever it happened to be at a given time, senior managers ... implementation of strategic plans, as well as operational plans Now, project management had the attention of senior agement man-Another factor promoting project management was the acceptances of

Ngày tải lên: 14/08/2013, 13:47

271 631 2
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... paper It is found that a uniform grid arrangement is also best in the case of a VAWT for optimal power generation Wake, power and cost modeling of a HAWT 2.1 Jensen's wake modeling of a HAWT All ... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is

Ngày tải lên: 05/09/2013, 17:03

12 636 1
Strongly Typed Object SQL

Strongly Typed Object SQL

... hold a database reference With strongly typed object SQL, you'll use a custom Java class to manipulate a database object, an Array object or another custom Java class for a collection, and a Ref ... that we are now using the database as persistent storage for objects, not just for data Any application that accesses the database should be able to use an object's methods as well as its data ... custom Java classes to manipulate database-side SQL objects The classes themselves are referred to as custom because a Java class is created to mirror its database counterpart To mirror database

Ngày tải lên: 29/09/2013, 09:20

38 309 0
Updating Server Data Using .NET Remoting

Updating Server Data Using .NET Remoting

... DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet. da = new SqlDataAdapter("SELECT * FROM Orders", SQL_CONNECTIONSTRING); DataTable orderTable = new DataTable(ORDERS_TABLE); ... Northwind and a DataRelation between those tables. UpdateOrders( ) Takes a DataSet argument containing the changes made to the DataSet created by the LoadOrders( ) method, creates two DataAdapter objects ... DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add it to the DataSet. da = new SqlDataAdapter("SELECT

Ngày tải lên: 17/10/2013, 20:15

10 645 0

Bạn có muốn tìm thêm với từ khóa:

w