model 2 using a prior hba1c

... dynamic taxonomies Using metadata HTML and PDF formats, with open standard graphics Click on your answers Database management systems - Using a database for document retrieval - page Using a database ... systems - Using a database for document retrieval - page 10 Metadata search We can implement an indexed metadata search using database technology in several ways Here you can look at three of ... these: Metadata are in the tables of a relational database and link to document text held either on the file system or in other tables Table Table Text Documents metadata Database Metadata are represented...

Ngày tải lên: 31/03/2014, 20:20

... Enabled Enabled Netscape Navigator 4.0 and later Enabled Enabled Enabled Disabled Netscape Navigator 3.0 and later Enabled Enabled Disabled Disabled Both Internet Explorer and Navigator 4.0 and ... Coordinator: John Williams Manufacturing Support: Laura King; Kathy Hershey Lead Product Manager, Release Management: Bo Galford Group Manager, Courseware Infrastructure: David Bramble General Manager: ... Sangeeta Nair, Vijayalakshmi Narayanaswamy (NIIT); Veena Nambier, Yatinder Walia (NIIT) Technical Contributors: Scott Swigart (3 Leaf Solutions); Gary Gumbiner (Great Barrier Technologies, Inc.) Graphic...

Ngày tải lên: 06/07/2014, 09:25

... Primer-1 5’-CGGATATTGTAKTCCTGGTCGTA-3’ Primer -2 5’-CCTGTCCTAGATTCCCCTATTGATT-3’ Probe FAM-5’-CTAGGCCTACGTGGTCTACATTTC-3’-TAMRA Three PCV2-positive samples and 37 serum and tissue unknown samples were ... Shanghai Agricultural Science Committee foundation of China, grant no .20 09-6-4 International Cooperation Foundation of Shanghai grant no.10410703500, Shanghai agricultural science key research ... Science and Veterinary Medicine, Shanghai Academy of Agricultural Sciences, 29 01 Beidi Road, Shanghai, 20 1106, People’s Republic of China 3Key Laboratory of Agricultural Genetics and Breeding, Shanghai...

Ngày tải lên: 11/08/2014, 21:21

... on statistical data analysis, and all of the HUPO PPP participating laboratories for making their data available for this analysis The collaborative HUPO Plasma Protein study and the data analysis ... software packages rely on a protein database against which to search As a result, even the most exhaustive protein database search is limited to the data available in the current public databases ... yields an estimated 1,019 additional genes Proc Natl Acad Sci USA 20 03, 100:1140-1145 de Souza SJ, Camargo AA, Briones MR, Costa FF, Nagai MA, Verjovski-Almeida S, Zago MA, Andrade LE, Carrer...

Ngày tải lên: 14/08/2014, 16:21

... minimum and maximum annual average acceptance rates to be 999 .2 mg/year and 1000.8 mg/year respectively The mean, variance, and standard deviation are 1000 mg/year, 0.0504, and 0 .22 5 respectively ... dioxide are the major gases produced by biodegradation of landfill wastes [2- 4, 7] According to Scheutz et al [2] , the biodegradable organic material in waste includes paper, animal and vegetable matter, ... type CAA Conventional CAA Arid area Inventory Conventional Inventory Arid area Inventory Wet (bioreactor) Source: [11] CAA = Clean Air Act (1970) K (year-1) 0.05 (Default) 0. 02 0.04 0. 02 0.7...

Ngày tải lên: 05/09/2013, 16:11

... SqlConnection("server=localhost;database=Northwind;uid=sa;pwd=sa"); // monitor the StateChange event using the StateChangeHandler() method mySqlConnection.StateChange += new StateChangeEventHandler(StateChangeHandler); ... example defines a method named StateChangeHandler to handle the StateChange event You'll notice that the second parameter to this method is a StateChangeEventArgs object You get the original ... illustrates the use of the StateChange event Listing 7.3: STATECHANGE.CS /* StateChange.cs illustrates how to use the StateChange event */ using System; using System.Data; using System.Data.SqlClient;...

Ngày tải lên: 14/12/2013, 13:15

... actions that define the relationship between each pair of entities, and label the line with the relationship verb This is the initial ER diagram for the logical data model Answer in v04_160 9a_ act 42- 1.bmp ... v04_160 9a_ act 42- 1.bmp Activity 4 .2: Creating a Logical Data Model Exercise 2: Determining Cardinality and Existence In this exercise, you will use the syntax discussed in the module to identify the cardinality ... cardinality and existence characteristics of each of the relationships defined in Exercise ! Identify cardinality For each relationship on your ER diagram, ask the question “How many of the parent...

Ngày tải lên: 21/12/2013, 06:16

... incorporating a probabilistic generative model. 1 Their parameters can be estimated from either labelled data, using maximum likelihood estimates, or from unlabelled data by expectation maximization2 which ... ROMODES H in such a way that the new algorithm applies a first-order boundary model and a second-order transition model A transition t ji is now defined as a transition from an abstract symbol in l ... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each...

Ngày tải lên: 20/02/2014, 04:20

... Japanese) Sato, S and Nagao, M (1990) Toward memory-based translation, Coling-90, pp 24 7 -25 2 Sumita, E (20 00) Word alignment using matrix PRICAI-00, 20 00, (to appear) Tanaka H (1995) Statistical Learning ... “Case Frame Tree” for Translating English Verbs, Journal of NLP, 2/ 3, pp 49- 72, (in Japanese) Yamada, S., Sumita, E and Kashioka, H (20 00) Translation using Information on Dialogue Participants, ... overall accuracy 5 .2 Data sparseness In our proposal, deficiencies in the naïve implementation of vsm are compensated in several ways by using a thesaurus, grouping, and clustering, as explained...

Ngày tải lên: 20/02/2014, 18:20

... using a $class facet and mapping information to the database schema using a Sstorage facet The value of a Sstorage facet denotes the class name which has mapping information The sales class has ... Natural Language Data Base Interface, Proc Conf Applied Natural Language Processing, 1983, pp .25 -30 Grosz, B J., TEAM: A Transportable NaturalLanguage Interface System, Proc Conf Applied Natural Language ... 12 Evaluation of KID 21 1 Izumida, Y et al., A Database Retrieval System Using a World Model, Symposium on Database System, 43 -2, Information Processing Society of Japan, 1984 [in Japanese] Makinouchi,...

Ngày tải lên: 09/03/2014, 01:20

... produced after transfer, and make appropriate pragmatic decisions RELATING SURFACE AND ABSTRACT SPEECH ACTS A problem in translating dialogues is to translate adequately the speaker's communicative ... English 2a~ Aarld new PROP symbols in the translate.act, txans-speaker and trans-hearer slots [japanese: JASA [speech-act-type: #sat~EQUEST, manner: #man=DIRECT, speaker: # j-sp-J-SPEAK~ hearer: ... propositional content has (I) a lexical head, (2) a set of syntactic featur~ (such as tense-aspect-modality, determination, gender and may have (3) a set of ), dependents which are analyzed as case...

Ngày tải lên: 17/03/2014, 20:20

... interface a ordance (e.g., sort search results based on different meta-data), or search paradigm (e.g., engage in an instant messaging conversation with a domain expert) to encourage them to stay ... initialized at the start of every sequence, Xi ∈ DY , and the automata make transitions whenever suitable events appear as we proceed down the sequence When an automaton reaches its final state, a full ... our logs contained a search engine switch 6.3 Sequence representation We represent each search session as a character sequence This allows for easy manipulation and analysis, and also removes...

Ngày tải lên: 23/03/2014, 13:20

... conference on Artificial intelligence (vol 1), AAAI ’94, pages 779–784, Menlo Park, CA, USA American Association for Artificial Intelligence Lavie, A and Agarwal, A (20 07) Meteor: an automatic metric ... that word being inserted Thus we have 15 parameters for this noise model a: a/0.6 ε:ε/1 ε:ε/1 an:an/0.4 4.3 Learning noise model parameters cat:cat/1 ear:ear/1 ear:ear/1 cat:cat/1 an:an/1 a: an/0.05[0,0.05] ... in machine translation, BLEU (Papineni et al., 20 02) and METEOR (Lavie and Agarwal, 20 07) Machine translation addresses the problem of changing a sentence in one language to a sentence of another...

Ngày tải lên: 23/03/2014, 16:20

... kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% ... of characters other t h a n punctuation marks: kanji, hiragana, katakana, R o m a n 3.4 P a r t o f S p e e c h a n d W o r d M o r p h o l o g y alphabet, and Arabic numeral Kanji which means ... speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams for each part of speech in the infresyllabaries: The former is used primarily for grammatical...

Ngày tải lên: 23/03/2014, 19:20

... sections, any finite memory Markov model cannot capture the recursive nature of natural language The VMM can accommodate longer statistical dependencies than a traditional full-order Markov model, ... computational complexity of approximating distributionsby probabilistic automata, Machine Learning, Vol 9, pp 20 5 -26 0, 19 92 D Ron, Y Singer, and N Tishby, Learning Probabilistic Automata with Variable ... Statistical decision theory and Bayesian analysis, New-York: Springer-Verlag, 1985 E Brill Automatic grammar induction and parsing free text: A transformation-based approach In Proceedings of ACL...

Ngày tải lên: 23/03/2014, 20:21

... leaving a set of 20 2 words (the “gold standard”) on which at least of the annotators agreed The best agreement between the gold standard and a human annotator was 0.87 kappa, and the worst was ... http://research.microsoft.com/~minka/software/fastfit/ 87 trained to identify homographs using sets of dictionary definitions After training, each of the 22 5 words was annotated by each annotator On average, ... formulate the homograph detection process as a generative hierarchical model Figure provides the plate notation of the graphical model The latent (unobserved) variable Z models the class information:...

Ngày tải lên: 31/03/2014, 00:20

... Tanner, Martin A and Wing Hung Wong 1987 The calculation of posterior distributions by data augmentation Journ of the American Statistical Association, 82( 398): 528 -540 Wong, S.K.M and Y.Y Ya~ ... Pattern Recognition in Practice, pages 381-4 02 Lewis, David D 19 92 An evaluation of phrasal and clustered representations on a text categorization task Proc of SIGIR'9~, pages 37-50 Lewis, David ... that a word like 'ball' in a document refers to a 'tennis ball' and not a 'soccer ball,' so as to classify the document more accurately; Table 14: The second data set Num of doc training data...

Ngày tải lên: 31/03/2014, 21:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... that the actions of the agent are mediated, at least in part, at interneuronal sites [21 ,22 ], and not just at motoneuron synapses Tizanidine actions are believed to be mediated via the restoration ... Lglesias C, Cavallari P, Pierrot-Deseilligny E, Marchand-Pauvert V: Mediation of late excitation from human hand muscles via parallel group II spinal and group I transcortical pathways J Phys 20 06, ... the manuscript DC referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the final manuscript...

Ngày tải lên: 19/06/2014, 08:20