... examination 7.3.3 Condition and classification of the decayed, filled and missing teeth Number and condition of remaining teeth were examined separately for the maxilla and the mandible Indications ... events in life This must be kept in mind in the interpretation of interview data 9.2 Loss of natural teeth In Finland, a clear increase in the number of subjects acquiring dentures was seen in the ... better living conditions and financial situation at that time Increased use of fluoridated toothpaste since its introduction in Finland in 1962 has obviously played an important role in this development...
Ngày tải lên: 05/03/2014, 18:20
... intelligent, animated, spirited, attractive, inviting, intriguing, provocative, though-provoking, challenging, inspiring, involving, moving, titillating, tantalizing, exciting, entertaining, piquant, ... engrossing, absorbing, consuming, gripping, arresting, enthralling, spellbinding, curious, captivating, enchanting, bewitching, appealing Keep - hold, retain, withhold, preserve, maintain, sustain, ... query, interrogate, examine, quiz - 12 - Bright - shining, shiny, gleaming, brilliant, sparkling, shimmering, radiant, vivid, colorful, lustrous, luminous, incandescent, intelligent, knowing, quickwitted,...
Ngày tải lên: 14/12/2013, 16:45
Using dialogue and drama activities in teaching speaking skill to the 11th form students at nghen high scholl in ha tinh province
... Spending two months on training teaching, the author had a chance to find out the real state of learning English speaking at Nghen high school in particular and in Ha Tinh province in general During ... choices, thinking of new ideas, and interpreting familiar material in new ways are essential to drama Without imagination, education becomes a kind of intellectual recycling of the same knowledge ... Stamp-collecting Mountain-climbing Playing computer games Reading books Watching TV Chatting with a friend on the Name Reason phone Handout B Go around interviewing your classmates to find someone...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu CULTURAL AND REPRODUCTIVE SUCCESS IN INDUSTRIAL SOCIETIES: TESTING THE RELATIONSHIP AT THE PROXIMATE AND ULTIMATE LEVELS docx
Ngày tải lên: 13/02/2014, 16:20
Tài liệu Area Socioeconomic Variations in Cancer Incidence and Stage at Diagnosis in New Jersey, 1996-2002 pdf
... of inflammatory bowel disease, smoking, alcohol use, physical inactivity, and a diet high in saturated fat and/ or red meat and low in fruits and vegetables • The lower incidence for whites and ... and urinary bladder cancer To compare incidence rates in the poverty area groups, incidence rate ratios (RR) were calculated as the ratio of the incidence rate in a poverty area group to the incidence ... for pancreatic cancer include increasing age and cigarette smoking Possible risk factors include diabetes, chronic pancreatitis (inflammation of the pancreas), obesity, and certain occupational...
Ngày tải lên: 14/02/2014, 21:20
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx
... amplied using a forward primer (FWN1: 5Â-TACCG TTAACATCGATATGCATCATCATCATCATCATAC-3Â), designed to introduce a ClaI restriction site at nucleotide position and a reverse primer (REVN1: 5Â-CCTGCC ATTGCTTGCAGCC-3Â) ... N-terminal hexahistidine tag was obtained by PCR using the pET21a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI ... rotational tumbling times of Ordered and disordered protein domains proteins containing disordered segments, and highlighted the effects of the unordered regions on the properties of covalently linked...
Ngày tải lên: 18/02/2014, 04:20
Chemical contamination at e-waste recycling and disposal sites in Accra and Korforidua, Ghana pptx
... laws, regulations and administrative provisions of the Member States relating to restrictions on the marketing and use of certain dangerous substances and preparations (phthalates in toys and childcare ... used in coated wires and cables, one of the main materials burned at the sites investigated The extent of workplace contamination found in Ghana was similar to that reported for locations in other ... found in the indoor environment, including in air and dust (Otake et al 2001, Butte & Heinzow 2002, Fromme et al 2004) Phthalates are commonly found in human tissues, including in blood and, as...
Ngày tải lên: 05/03/2014, 21:20
Báo cáo khoa học: Investigation of the kinetics and order of tyrosine phosphorylation in the T-cell receptor f chain by the protein tyrosine kinase Lck potx
... each containing a single tyrosine, are good representatives of the individual tyrosines on the larger, multityrosine-containing TCRf chain because CD studies [10] and our NMR data show that the ... of its catalytic domain to reach the remaining unphosphorylated tyrosines of TCRf However, our studies using peptides containing single tyrosines show that Lck is capable of phosphorylating all ... electrostatic interactions in SH2 domain recognition: salt dependence of tyrosyl-phosphorylated peptide binding to the tandem SH2 domain of the Syk kinase and the single SH2 domain of the Src kinase...
Ngày tải lên: 08/03/2014, 02:20
Scholarships for Master Programmes in Public Policy and Good Governance at Universities in Germany pot
... international institutions of higher learning in Germany and enjoys a vibrant international community Another chance of getting access to an international network is provided by taking part in ... national and international administration as well as in multinational and global business companies or to work as a political consultant with interest groups and political parties Prof Dr Winand Gellner ... and a team of tutors, buddies and mentors assist the students in adjusting to life and study in Osnabrück In addition, the International Faculty Office at the Faculty of Business Management and...
Ngày tải lên: 08/03/2014, 04:22
MATERNAL, NEWBORN AND CHILD HEALTH IN NIGERIA: WHERE ARE WE NOW? pptx
... • Adoption and implementation of the Integrated Maternal, Newborn and Child Health Strategy – Institutionalisation of bi-annual MNCH week • Strengthening Institutional capacity and Infrastructure ... diarrhoea and pneumonia): strategy being fine tuned Current Strides To Meet MDG Targets • Health Financing – National Health Insurance and Community Based Health Insurance Scheme in selected states ... Focused Antenatal Care Intrapartum Care Emergency Obstetric and Newborn Care Routine Postnatal Care Newborn care Infant and Young Child Feeding (IYCF) Prevention of malaria using LLINs and IPT Priority...
Ngày tải lên: 08/03/2014, 15:20
COMPUTER AND INTERNET USE AT WORK IN 2003 pot
... Sales and related occupations Office and administrative support occupations Natural resources, construction, and maintenance occupations Farming, fishing, and forestry occupations Construction ... transportation, and material moving occupations Production occupations Transportation and material moving occupations INDUSTRY Total, 16 years and over Private wage and salary ... 8,392 Installation, maintenance, and repair occupations 5,341 Production, transportation, and material moving occupations 18,189 Production occupations 9,736 Transportation and material...
Ngày tải lên: 15/03/2014, 22:20
Báo cáo khoa học: Three novel carp CXC chemokines are expressed early in ontogeny and at nonimmune sites ppt
... nervous system patterning In addition, the constitutive expression of CXCL14 in adult carp and mouse brain indicates a role in normal brain physiology These functions in patterning and maintenance ... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... monocyte-activating chemokine (BMAC), a novel non-ELR alpha-chemokine Int Immunol 12, 677–689 11 Klein, R.S & Rubin, J.B (2004) Immune and nervous system CXCL12 and CXCR4: parallel roles in patterning and...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Acetyl-CoA:1-O-alkyl-sn-glycero-3-phosphocholine acetyltransferase (lyso-PAF AT) activity in cortical and medullary human renal tissue docx
... percentage inhibitory activity of 0.7 mM creatine phosphate/ aliquoted and stored at – 30 °C All homogenization and 4,5 creatine phosphate kinase, 10 lM indomethacin and 0.1 lM fractionation procedures ... system of creatinine phosphate and creatinine phosphate kinase exerted the same inhibitory effect on both standard PAF and the lipid product of similar aggregatory activity Mild alkaline hydrolysis ... maintained at kept in ice for 30 and centrifuged at 10 000 g for 4000 V The supernatant was discarded and the pellet containing the [H3]PAF bound to the denaturated BSA is dissolved in the scintillation...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Sin3 is involved in cell size control at Start in Saccharomyces cerevisiae Octavian Stephan and Christian Koch ppt
... of Sin3 and or Rpd3, rather than by regulating Sin3 ⁄ Rpd3 directly A good candidate for a factor regulating Sin3 ⁄ Rpd3 binding is Stb1, because it binds to both Swi6 and Sin3 [20,21,32,34] In ... were inoculated in fresh medium and incubated at 25 °C Binding of Sin3–myc to promoters was analysed at different time points by ChIP (F) PCL1 and CMD1 RNA levels determined by hybridization ... by Sin3 in the G1 phase At 160 min, most cells in the culture had left G1 and exhibited no Sin3 binding to the promoter (Fig 6E) Analysis of G1 cyclin expression showed that binding of Sin3 to...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khóa học: Large aggregating and small leucine-rich proteoglycans are degraded by different pathways and at different rates in tendon pot
... the matrix of the tissue immediately after incubation of the tissue with [35S]sulfate and at various time points in culture remained constant The presence of unincorporated [35S]sulfate early in ... represent intact core protein of aggrecan and V0 and/ or V1 splice-variants of versican [1] With time in culture, a distinct band at 300 kDa (indicated by asterisk) appeared, and remained in the matrix ... apparent that the decorin core protein of 43 kDa (lane i) present in tissue immediately after incubation with [35S]sulfate, decreased in size with time in culture (lanes ii and iii) indicating extracellular...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo hóa học: " EQ-5D visual analog scale and utility index values in individuals with diabetes and at risk for diabetes: Findings from the Study to Help Improve Early evaluation and management of risk factors Leading to Diabetes (SHIELD)" potx
... diabetes) Using the methodology of Cavrini and associates and Sitoh and colleagues [18,19], an ordinal variable for the EQ-5D index was created by categorizing the continuous variable into levels, and ... assessing each individual's health status, health knowledge and attitudes, and current healthrelated behaviors and treatments A total of 22,001 baseline survey questionnaires were mailed in late ... US valuation of the EQ-5D health states: Development and testing of the D1 valuation model Med Care 2005, 43:203-220 Sapin C, Fantino B, Nowicki M, Kind P: Usefulness of EQ-5D in assessing health...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Alendronate increases BMD at appendicular and axial skeletons in patients with established osteoporosis" docx
... summarizes bone forming serum alkaline phosphatase (BALP) and urinary Deoxypyridoline (DPD) in both Alendronate group and control group at baseline and their changes at 6-months and 12-months The ... Alendronate treatment effect was revealed greater in weight bearing bones (5.1% at lumbar spine and 2.5% at femoral neck) that non-weight bearing non-dominant distal radius (0.9% in tBMD, 0.2% in ... baseline BMD between Alendronate group and control group There is a significant increase in BMD in Alendronate group, with on average 5.1% at spine and 2.5% at femoral neck after 12 months treatment...
Ngày tải lên: 20/06/2014, 00:20
The study: An analysis of common errors on verb tenses and word choices in VietnameseEnglish translation by the secondyear English majors at Dong Thap University
... idioms using in and into: run into debt, rush into print, step into a practice, 14 jump into a fight, dive into a book, stumble into acquaintance, fall in love, break into society, etc In spite ... combinations, one cannot say the following break into debt, fall into print, rush into a fight or dive into debt The combinations are fixed as to form and their meaning comes from their combination ... versus idiomatic translation 1.3.2 Translating grammatical features 1.3.3 Translating lexical features 1.4 Strategies for translation 1.5 The factors influencing translation process 1.5.1 The...
Ngày tải lên: 03/07/2014, 14:17
Báo cáo toán học: " Tight Quotients and Double Quotients in the Bruhat Order" doc
... characterizations of Bruhat ordering on a Coxeter group and determination of the relative M¨bius function, Invent Math 39 (1977), o 187–198 [D2] V V Deodhar, On Bruhat ordering and weight-lattice ordering ... identification of all points θ ∈ A0 such that (5.1) holds In such cases, we say that the Bruhat ordering of (W θ)S is tight B Orbit stratification Recall that the tightness of the Bruhat ordering of ... to realize that the Bruhat ordering of W \W /W is isomorphic to the usual ordering of dominant co-weights: moving up in this Bruhat order is equivalent to adding positive combinations of positive...
Ngày tải lên: 07/08/2014, 08:22