mining redo log files in a given time range

Quản lý redo log files

Quản lý redo log files

... o database Các tham s dư i ây xác nh gi i h n s lư ng c a online redo log files: Tham s MAXLOGFILES l nh CREATE DATABASE xác nh s lư ng t i a online redo log groups S lư ng t i a cho MAXLOGFILES ... tr redo log files Qu n tr viên database c n ph i quy t NOARCHIVELOG cho database Ch nh t ch ARCHIVELOG hay ch NOARCHIVELOG V i ch NOARCHIVELOG, online redo log files s b ghi è m i online redo log ... lên datafiles Background process CKPT c p nh t ph n headers c a data files control files Checkpoints có th x y i v i t t c data files database ho c có th x y v i m t data files c th Checkpoint...

Ngày tải lên: 09/10/2013, 13:20

14 733 5
Optimal security design and dynamic capital structure in a countinous time agency model DEMARZO & SANNIKOV

Optimal security design and dynamic capital structure in a countinous time agency model DEMARZO & SANNIKOV

... time Because the agent can always underreport and steal at rate γR until termination, any incentive compatible strategy yields the agent at least R In contrast, this constraint may bind in a discrete -time ... parameters on the agent’s starting value W* when investors have all the bargaining power is determined by the following tradeoff: Larger W* delays termination at a greater cost of paying the agent ... principal randomizes when the agent defaults) Second, because cash flows may be arbitrarily negative in a continuous -time setting, the contract may involve a compensating balance requirement as...

Ngày tải lên: 12/01/2014, 22:16

51 562 0
Tài liệu Managing Files in a Printer Queue doc

Tài liệu Managing Files in a Printer Queue doc

... In the printer queue menu bar, click File and choose Pause Printing This will cause the printer queue to hold all print jobs without sending any information to the printer Minimize the printer ... the printer queue handles jobs using First In, First Out (FIFO) Sometimes it is necessary to give priority to certain print jobs In the printer queue window, drag low to an area below high and ... Sometimes it is necessary to cancel print jobs while they are being held in the printer queue In the printer queue window, right-click on “medium.txt” What options are available in the context-sensitive...

Ngày tải lên: 24/01/2014, 19:20

3 284 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt

Đề tài " The distribution of integers with a divisor in a given interval " ppt

... of intervals Ii is ≤ 2τ (a) + ≤ 3τ (a) , and thus log( yj /p)∈S p log p meas(L ) τ (a) + + (a) ) log (yj /a + P log1 0 zj INTEGERS WITH A DIVISOR IN AN INTERVAL 403 Next, we sum on a, j and s in ... O(η∆ (log y)−18 ) y

Ngày tải lên: 06/03/2014, 08:21

68 412 0
Maintaining Online Redo Log Files ppt

Maintaining Online Redo Log Files ppt

... Archived Redo Log Files • Filled online redo log files can be archived • There are two advantages in running the database in ARCHIVELOG mode and archiving online redo log files: – Recovery: A ... Relocating or Renaming Online Redo Log Files Relocate or rename online redo log files in one of the two following ways: • ALTER DATABASE RENAME FILE command – – – – – Shut down the database Copy ... the online redo log files to the new location Place the database in MOUNT mode Execute the command Open database for normal operation ALTER DATABASE RENAME FILE '$HOME/ORADATA/u01 /log2 a. rdo'...

Ngày tải lên: 23/03/2014, 00:20

19 185 0
beyond rationality the search for wisdom in a troubled time jan 2007

beyond rationality the search for wisdom in a troubled time jan 2007

... With offices in Argentina Austria Brazil Chile Czech Republic France Greece Guatemala Hungary Italy Japan Poland Portugal Singapore South Korea Switzerland Thailand Turkey Ukraine Vietnam Copyright ... Intuition: Seeking Empirical Accuracy the Easy Way 145 11 Analysis: Seeking Empirical Accuracy the Hard Way 163 12 Intuition: Seeking Rationality the Easy Way 173 13 Analysis: Seeking Rationality ... analysis Much of modern management writing talks about intuition and management craft, rather than analysis Intuition is always necessary—and may be better in the end than extensive analysis.”4...

Ngày tải lên: 11/06/2014, 10:32

363 190 0
báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

báo cáo hóa học:" Prevalence of visual impairment in relation to the number of ophthalmologists in a given area: a nationwide approach" ppt

... OECD: Maintaining propriety in an Aging Society Paris 1998 Resnikoff S, Pascolini D, Etya'ale D, Kocur I, Pararajasegaram R, Pokharel G, Mariotti S: Global data on visual impairment in the year 2002 ... geographical area were available During the 1999 national census a filtering survey called "Everyday Life and Health" was added A total of 2,275 geographical areas were picked at random from ... visual impairment rates and indicators of other eye-care activities, such as number of visits/inhabitant, glaucoma diagnosis campaign, etc Inequality of quality of care could also be a factor...

Ngày tải lên: 20/06/2014, 15:20

8 447 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR

... TaqMan Probes used Primer and Probe Sequence (5’-3’) Reference MF MR gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc ... cultivation Table shows the strains examined in this study MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) MD-1 strain can degrade the microcystin analogs, microcystin-RR, ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities...

Ngày tải lên: 05/09/2013, 10:15

9 525 0
The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

The JSP Files (Part 1) - Purple Pigs in a Fruitbasket

... the application server for JavaBeans and servlets, and the database server for database connectivity Additionally, you can combine JSP with JavaBeans and Java servlets to create complex Web applications ... org.apache.tomcat.core.ServletWrapper.doService(ServletWrapper.java:404) at org.apache.tomcat.core.Handler.service(Handler.java:286) at org.apache.tomcat.core.ServletWrapper.service(ServletWrapper.java:372) at org.apache.tomcat.core.ContextManager.internalService(ContextManager.java: ... references such as this one Java In A Teacup Enter John Doe Variables are the bread and butter of every programming language and JSP has them too A variable can be thought of as a programming construct...

Ngày tải lên: 19/10/2013, 02:15

16 325 0
Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

Tài liệu Báo cáo khoa học: "Paraphrasing Using Given and New Information in a Question-Answer System" docx

... Sentence Reptuentatton in Natural Language Inferenctng', to appear in IJCAI Proceedinqs 79 13 [KAMAN79] Kaplan, S J , "Cooperative Responses from a Portable Natural Larquage Data Base Query System', ... which flatten the tree The final stage of processing in the paraphraser is translation In the translation phase, labels In the parser's representation are translated into their corresponding words ... r Academia, Prague, ~ ~ [FIRBAS R6] Firhas, Jan, "On Defining the Theme in Functional Sentence Analysis", Travaux Lin~uistigues de Prague i, Univ of Alabama P r e s ~ [FIRBAS 74] Firbas,Jan,...

Ngày tải lên: 21/02/2014, 20:20

6 536 0
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

THE CONSTITUTION OF LAW Legality in a Time of Emergency potx

... United Kingdom, Australia, and Canada in order to show that law provides a moral resource that can inform a rule-of-law project capable of responding to situations which place legal and political ... and found that he was right in every particular, and a page and a half of that judgment is really in that way the work of General Smuts rather than myself.15 Foxton continues that Shaw was particularly ... that Smuts was a racist, whose own policies in South Africa laid the basis for apartheid: after all, in holding racist views, he was in the mainstream of politics Rather, he strongly favoured a...

Ngày tải lên: 07/03/2014, 02:20

268 663 0
School Crisis Guide: Help and Healing in a Time of Crisis pot

School Crisis Guide: Help and Healing in a Time of Crisis pot

... activities Make mental health services available, including Employee Assistance Program, if applicable Practice active listening and acknowledge pain and anxiety as well as a healing process that has ... see what other state affiliates are doing Existing NEA State Affiliate Crisis Response Teams ● California Teachers Association: CTA Traumatic Events Assistance and Management Cadre (TEAM CADRE) ... students, families and staff? ● Provide regular information updates and maintain open communication with teachers, other staff and parents? ● Monitor rumors and maintain timely, accurate information?...

Ngày tải lên: 14/03/2014, 20:20

52 333 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_2 pptx

... is in another league If training programs were animals, HFT for Arms would be a pit bull- a tough sumbitch by any standard- while Total-Body HFT is Sasquatch The end results are as unique as a ... you're targeting But as of your elbow joints than they can handle THEPLANS The easiest fix is to use a variety of hand fifth week Rather than taking the entire week positions-neutral (palms facing ... stranger limb, Rest after working bath sides, 114 STANDING SINGLE-LEG CALF RAISE* (PAGE 280) FRONT SQUAT (PAGE 242 ) TOTAL REPS: 15 REST (SECONDS): 45 BULGARIAN SPLIT SQUAT* (PAGE 248) TOTAL...

Ngày tải lên: 14/03/2014, 23:20

112 533 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_3 pot

... vertical than you can with a traditional squat, and thus increase your range of motion UP: Return to the starting position and exhale 242 VARIATIONS: 2» 1» FAST PARTIAL FRONT SQUAT SUPRAMAXIMAL ... Sometimes you'll find a stand-alone dip station Other times it's part of a device called the "captain's chair" that is used for an ab exercise resembling the hanging leg raise Newer gyms have a ... Stronger, standing chest press, starting with your weaker or non- Phases and 2; Get Lean, Phase dominant arm Hold your nonworking arm HOW TO DO IT: Same as for standard cable behind your back PUSHUP...

Ngày tải lên: 14/03/2014, 23:20

98 453 1
Geochemistry of inorganic arsenic and selenium in a tropical soil  effect of reaction time, ph, and comp

Geochemistry of inorganic arsenic and selenium in a tropical soil effect of reaction time, ph, and comp

... potential groundwater and surface water contamination by these contaminants Arsenic can exist in inorganic form, organic form, and gaseous state The oxidation states of As in the natural systems are ... values of their parameters as well as the correlation of determinations (r2 ) Arsenate and Se(IV) adsorption increased significantly with increased adsorbate loading initially and then increased ... the Examination of Water and Wastewater American Public Health Association, NW, Washington, DC Carbonell Barrachina, A. A., Burl Carbonell, F.M., Mataix o Beneyto, J.J., 1996 Kinetics of arsenite...

Ngày tải lên: 16/03/2014, 00:25

11 835 0
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_4 pptx

... Typical reactions include bloating, diar- happens to be a naturally occurring trans fatty rhea, and gas I mean really, really, really bad acid, found in meat and cheese The ones you gas So avoid ... protein there is in a few categories of with each meal and snack A serving of fruit is food that you'll typically eat Soon you'll be an apple, banana, orange, peach, or pear, or a able to plan and ... FEEDING FOR HARDGAINERS ONLY fat more easily than muscle True hard gainers-as opposed to guys 100-150 1/2 ba nana* 10 grams grams 150-200 banana 20 grams grams 200+ ba nana 30 gram s 10 grams...

Ngày tải lên: 22/03/2014, 16:21

57 393 1
Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

Men''''s Health Huge in a Hurry: Get Bigger, Stronger, and Leaner in Record Time with the New Science of Strength Training_1 doc

... ever asks you about that challenge as well as a physical pursuit You read Then one day, without meaning to, you more about training, gaining a working knowl- come across the information that completes ... when small bundles of small fibers are activated, there's a relatively modest change in muscle tension But, as I explained in Chapter 1, those small fibers can maintain that modest increase in tension ... big pain and big What he's really doing, in all likelihood, is muscles seems obvious and inarguable, and the articles that accompany the photos rein- platform on a leg-press machine starts in the...

Ngày tải lên: 22/03/2014, 16:21

103 558 2
Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf

Finding Surprising Patterns in a Time Series Database in Linear Time and Space pdf

... 6e foăha9{9Dj#fD`ệo(`p$D(D9D`(Dệy 10 ba$   ba$ 11 aba $ 12 14 aba $    13 15 aba $ 16 ba$ aba ba$ $ aba   ba$ aba $ $ aba aba $ aba $ ba   18 aba aba $ ba 17 aba 19 aba w b B V ... Ô9DD1găƯ$AG(9ipA9Dgiq(Ưf#D(i34ÔDGfwcT PT X b CF B @ C B @ X eT ự E e C R S S B C V R T c(Ô9ÔGqfa#DwDcệÂujD$(Ô(YqYtă7WhÔÂG a b a a b a b a a b a a b a b a a b a b a $ $ ba 20 $ ba aba $ aba ...  G )   A 43 ) & A 29âhB9o#C2{93ĂIB I âílƠ24c ) A 3 &   ) Ưâl(## G3 ) A 43 ) H2aCâ#ÔeC#Ư y & $ ỏfrr V A & WaC#rƯWD   & A ) A  ) 2s|d1#pâ|@7fƯẹ...

Ngày tải lên: 30/03/2014, 13:20

11 486 0
LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

LORD NEUBERGER OF ABBOTSBURY, MASTER OF THE ROLLS JUSTICE IN A TIME OF ECONOMIC CRISIS AND IN THE AGE OF THE INTERNET ppt

... that that bargain could be maintained by entirely virtual hearings It may be hard to maintain the seriousness of litigation and the trial process unless court hearings take place in a physical ... finances mean that it is particularly important to bear in mind fundamental principles, because they must always be upheld In facing present challenges and in approaching the future, the starting ... the average marriage, we may be approaching a cross-over And a trial, whether criminal or civil, is the state in action, or the state in microcosm, and is therefore a particularly serious matter...

Ngày tải lên: 31/03/2014, 03:20

16 471 0

Bạn có muốn tìm thêm với từ khóa:

w