methods of circulating tumor cells ctc measurements

... value of CTCs supports the use of CTCs as an indicator of metastatic disease prior to the current classification of mCRC meaning it is detectable by CT/MRI Keywords: Circulating tumor cells, ... significance of detection of CTCs in patients with mCRC [41] Peach et al reviewed the prognostic value of postoperative detection of CTCs in non-mCRC patients and concluded that the presence of CTCs ... mechanisms of recurrence and metastasis of CRC are very complicated and remains un-clear Recurrence and metastasis may involve series of cell biological behaviors, including circulating tumor cells (CTCs),

Ngày tải lên: 06/08/2020, 04:31

... the detection of circulating CK20+ tumor cells in the blood of colon cancer patients d Prognostic influence of the detection of circulating CK20+ tumor cells in the bone marrow of colon cancer ... influence of the detection of pan-cytokeratin (A45-b/B3) positive tumor cells in the bone marrow of colon cancer patients.b Prognostic influence of the detection of EpCAM (BER-EP4) positive tumor cells ... tumor cells in the blood of colon cancer patients b Prognostic influence of the detection of disseminated CK20+ tumor cells in the bone marrow of colon cancer patients c Prognostic influence of

Ngày tải lên: 20/09/2020, 01:06

... yield of cancer cells, defined as the ratio of the number of cancer cells captured on the glass surface to the total number Fig 1 Nanotopography-based microfluidic chip for CTC capture. a Photo of ... changes in CTC number and tumor weight during tumor progression Tumor weight (c) from mice with MDA-MB-231 and SUM-149 tumor xenografts as a function of xenograft time Scatter plot (d) of CTC number ... Keshamouni5,7*†, Sofia D Merajver5,7*†and Jianping Fu1,8,9,10*† Abstract Background: Circulating tumor cells (CTCs) have shown prognostic relevance in many cancer types However, the majority of current CTC

Ngày tải lên: 20/09/2020, 15:16

... patients, inclusive of CK+CTCs (13/25, 52 %), CK−CTCs (14/25, 56 %), CK+CTC Clusters (6/25, 24 %), and apoptotic CTCs (13/25, 52 %) Seven of 25 (28 %) patients had PD-L1+CTCs; 4 of these patients ... identification of CTCs, CTC clusters, and apoptotic CTCs A more thorough description of CTC types identified on the Epic Sciences platform has been published previously [26] Briefly, all CTCs are of apoptotic ... CK+/PD-L1+CTCs Further breakdown of CK+/PD-L1+and CK−/PD-L1 + CTCs detected by tumor subtype and staging indicates that inclusion of CK−CTCs substantially increased sensitivity of PD-L1 + CTC detection

Ngày tải lên: 20/09/2020, 17:59

... microscopic image of a circulating tumor cell (CTC) detected using manual immunocytochemistry Unstained blood cells are visible around the stained CTC Trang 4of CTCs and patients as well as tumor characteristicswere ... distribution of the number of circulating tumor cells (CTCs) CTCs were detected using manual immunocytochemistry in the peripheral blood of 1221 patients with early breast cancer at the time of primary ... magnification to localize cells suspected of being CTCs; the identity of these cells was then validated by ob-servation at 63-fold magnification The determination of the presence of CTCs was based on

Ngày tải lên: 21/09/2020, 01:46

... posi-tive when 1 CTC was detected Enrichment of CTC by CD45 positive cell depletion in peripheral blood 4 ml of blood was used to isolate and enrich circulating tumor cells Red blood cells were lysed ... indi-cator of tumor spread, as invasive but localized tumors may shed CTC into the blood stream before a metastasis is established The CellSearch® system enumerates CTC based on the expression of epithelial ... (Isolation by Size of Tumor cells), on the whole more CTCS were detected by ISET than by Cell-Search®, mean 26 versus 2 CTCs/7.5 ml of blood (range 0–240 versus 0–15) [13] The limitation of the cell

Ngày tải lên: 23/09/2020, 00:03

... chemotherapy, CTC level increased over twofold com-pared to the CTC level at baseline in 87% (26 of 30) of patients After 2 cycles of chemotherapy, the CTC levels normalized in 63% (19 of 30) of patients ... increases circulating tumor cell (CTC) influx into the circulation of metastatic cancer patients (Met-pa) CTCs are a precursor of cancer metastasis, in which they can migrate as single CTCs or as CTC ... invasive tumor cells: (i) detach from the primary tumor, (ii) invade into the tumor stroma, (iii) intravasate into the blood vasculature, (iv) circulate in the bloodstream, becoming “circulating tumor

Ngày tải lên: 28/09/2020, 09:47

... cell lines of known high (LNCaP, MCF7) or low (PC3, A549) EpCAM expression Linear regression analysis of the number of identified tumor cells against the number of spiked-in tumor cells produced ... therange of cells spiked into the blood samples Detection of single-digit numbers of spiked-in mCTC Individually collected PC3 cells were spiked into 7.5 mL of whole blood using the CytePicker (see Methods) ... identified Upon review of the cells by a board-certified anatomic pathologist, two of the cells were determined to lack morphologic features of the mCTCs but did have features of squamous cells, con-sistent

Ngày tải lên: 30/09/2020, 10:50

... use of ImageJ program (NIH) CellSearch Trang 4images from all CTCs detected in patient samples andrepresentative images of 100 cells from MCF-7 cells were analyzed Accordingly, images of all CTCs ... identification of CTCs (by the use of immunofluorescence or the Cell-Search System) whereas the wide range of the vim/K scale promoted a finer categorization of EMT in breast cancer cells, the generation of ... status of CTCs via the establishment of a numerical“ratio” value of keratin and vimentin expression levels on a single cell basis Methods: Keratin expression was evaluated in 1262 CTCs from 61 CTC-positive

Ngày tải lên: 30/09/2020, 10:51

... Background: The prognostic value of circulating tumor cells (CTCs) detected with the CellSearch System in patients with colorectal cancer (CRC) is controversial The aim of our meta-analysis was to ... that the detection of CTCs in the peripheral blood with the CellSearch System has prognostic utility for patients with CRC Keywords: Circulating tumor cells, Colorectal cancer, CellSearch System, ... “dis-seminated tumor cells”, “isolated tumor cells”, “occult tumor cells”, “peripheral blood”, “colorectal cancer”, “colon cancer”, “rectal cancer”, “gastrointestinal cancer”, and“CellSearch System”

Ngày tải lên: 30/09/2020, 11:22

... Samples with < 5 CTCs/7.5 ml were classified as CTC−, those with≥ 5 CTCs/7.5 ml as CTC+ [11] CTC kinetics Trang 3(CTCKIN) were defined in terms of changes in CTC statusfrom CTCBL to CTC1C and categorized ... underwent CTC enumeration to determine CTCBLstatus, defined as posi-tive (CTCBL+) for≥ 5 CTC or negative (CTCBL−) for < 5 CTC per 7.5 ml of peripheral blood [11] Determination of CTC status ... whether CTC status at baseline (CTCBL) and after one cycle of a new line of treat-ment (CTC1C) and changes in CTC status from baseline to completion of one treatment cycle (CTC kinetics, CTCKIN)

Ngày tải lên: 14/10/2020, 13:29

... searched in Oct 2012 using the strategy of (circulating tumor cell OR circulating tumor cells OR CTC or CTCs OR isolated/circulating/ disseminated tumor cells OR ITC) AND (Gastric cancer or Gastric ... distribution of patients, source of control; 2) methods of studies including study design, methods of the inclusion of patients and controls, methods of CTCs detection, the blood volume, time and methods ... characteristics of studies including name of the first author, year of the publication, country of origin, markers of CTCs detection methods, mean/me-dian age, diagnosis criteria of gastric cancer, tumor

Ngày tải lên: 05/11/2020, 06:48

... Background: The molecular profiles of tumors may inform the selection of appropriate targeted therapies Circulating tumor cells (CTCs) reflect the real-time status of tumor genotypes CTCs exhibit high ... of tumors These cells reflect subpopu-lations of primary and/or metastatic tumor cells and are accessible by blood collection [12] The number of CTCs is correlated with prognosis in several tumor ... images of peripheral blood mononuclear cells (PBMCs) and circulating tumor cells (CTCs) CTCs can be distinguished from contaminated leukocytes by combining the fluorescence filters d Cells marked

Ngày tải lên: 06/08/2020, 07:56

... from date of CTC blood draw to the date of death Trang 4with censoring at date of last known vital status if lost tofollow-up Kaplan-Meier methods were used to determine the impact of CTCs at each ... analysis of circulating tumor cells from castration resistant metastatic prostate cancer BMC Cancer 2012;12:78. 13 Okegawa T, Nutahara K, Higashihara E Prognostic significance of circulating tumor cells ... Background: Circulating biomarkers are urgently needed in hepatocellular carcinoma (HCC) The aims of this study were to determine the feasibility of detecting and isolating circulating tumor cells (CTCs)

Ngày tải lên: 30/09/2020, 11:17

... prognostic significance of CTCs on GC patients with at less one outcomes (i.e., OS and RFS), (2) the forms of CTCs were tumor cells from blood mononuclear cells (MNCs), CTC-related molecular derivatives ... excision of primary and metastatic tumors directly stop the releasing of CTCs and cut off the bilateral communications between CTCs and tumor masses How-ever, if cancers fail to be cured, CTCs may ... to high levels as a result of tumor progression or recovery of tumor cells from dormancy In theory, CTC tests before interventions contain baseline information of CTC burden Their presence at

Ngày tải lên: 14/10/2020, 17:02

... mutation analysis of CTCs total CTCs collected* Number CTCs with PIK3CA exon 9 mutation PIK3CA exon 20 mutationNumber CTCs with -TOTALS CTCs circulating tumor cells, ND not determined *CTCs not analyzed ... Capecitabine + RAD001 (everolimus) CTCs circulating tumor cells (from blood), DTCs disseminated tumor cells (from bone marrow), TCs tumor cells from primary tumor or metastatic site All detectedPIK3CA ... accuracy of our sequencing method (Figure 3D). PIK3CA mutation analysis was then performed on the 242 EpCAM-captured single tumor cells (185 CTCs, 24 DTCs, and 33 tumor cells) Three out of 17 (18%)

Ngày tải lên: 14/10/2020, 17:23

... cause of cancer-related death in patients with solid tumors and it is often associated with the presence of circulating tumor cells (CTCs) in the peripheral blood of cancer patients [10] CTCs ... Information) Circulating tumor cells (CTCs) enumeration The number of CTCs present in 7.5 mL of blood was determined at different points during the patients’ treat-ments using the CellSearchTM ... single CTCs and clusters of associated CTCs (Table3) Usually, CTCs clusters were composed by five to 14 associated cells (Fig.2) Samples containing single CTCs, pooled single CTCs, and/or CTCs

Ngày tải lên: 04/12/2022, 15:51

... of Hematology & Oncology 2008, 1:2 http://www.jhoonline.org/content/1/1/2 Background Materials and methods The presence of circulating tumor cells (CTC) in peripheral blood and disseminated tumor ... More effort should be invested in optimizing these methods List of abbreviations CTC: Circulating tumor cells; PBMC: Peripheral blood mononuclear cells; CK19: Cytokeratin; B2M: Beta microglobulin; ... Understanding the biology of the background expression of tumor markers will be instrumental in development of more specific methods to detect CTC Isolation of PBMC from Whole Blood Blood was collected...

Ngày tải lên: 10/08/2014, 22:20

... lower numbers of cells after 14 days of culture (data not shown) The number of circulating CD14+ cells was reduced in SLE patients, although less pronounced than the number of circulating CD34– ... hematopoietic progenitor cells, but not on mature endothelial cells [19,21] During maturation of these cells, the expression of CD133 is lost The combined expression of CD34 and CD133, therefore, ... and CD133, therefore, defines a population of (immature) circulating progenitor cells Because of the low number of CD34 and CD133 (double-)positive cells in the peripheral blood, we chose to...

Ngày tải lên: 09/08/2014, 10:20

... Primer name GenBank Accession Number Sequence 5' – 3' ELF3 s AF016295 CTCGGAGCTCCCACTCCTCAGA ELF3 as EPHB4 s GCTCTTCTTGCCCTCGAGACAGT AB209644 EPHB4 as EGFR s AB209442 TACSTD1 as MGB1 s MGB1 as ... by RT-PCR for the panel of markers Seeding dilutions of MDAMB453 into normal blood resulted in consistent detection of all RT-PCR markers at a level of 10 cells per ml of blood (Figure 1) In samples ... per ml of blood (10 cells total), marker expression was detected in 2/3 samples indicating some loss of cells during the immunobead isolation In the main part of this study, the expression of the...

Ngày tải lên: 10/08/2014, 22:20