matching your product service with a global trend or need

Service with a Smile ppt

Service with a Smile ppt

... Fontenay Wind When you have an engine with no fuel, and fuel without an engine, and a life-and-death deadline to meet, you have a problem indeed Unless you are a stubborn Dutchman and Jan Van Artevelde ... enough, or they could not have gone to space It had been a year and a half now—an Earth year and a half on a nice little planet revolving around a nice little yellow sun Herbert, the robot, was obedient ... bring mankind priceless gifts from worlds beyond But Montcalm was a solid family man and what about that nude statue in the park? Charles Louis Fontenay The Jupiter Weapon He was a living weapon...

Ngày tải lên: 06/03/2014, 15:20

10 410 0
Engineering Concepts in Industrial Product Design With A Case Study of Bicycle Design

Engineering Concepts in Industrial Product Design With A Case Study of Bicycle Design

... kullanılan tasarım metotları ve bunların tasarım aktivitesi sürecindeki avantajları da konunun daha net bir şekilde a ıklanabilmesi amacı ile belirlenmiştir Bu çalışma, tasarım sistemleri alanının ... doğrultuda, endüstri ürünleri tasarımı alanının bazı mühendislik alanları ile birlikte, tasarım problemlerine ve araçlarına yaklaşımlarının karşılaştırılması gösterilmiştir Ayrıca, mühendislikte kullanılan ... design educators and researchers we need to reframe our goals to seek a comprehensive integrated theoretical framework that is operationally (computationally and behaviorally) defined as well as emotionally...

Ngày tải lên: 02/07/2014, 13:08

167 349 0
Reporting with a Windows Service

Reporting with a Windows Service

... adding the dataset or data table, please refer to Chapter for a walkthrough Step 2: Designing the Report Layout All right, we have our dataset in place with its data table and all the necessary columns ... REPORTING WITH A WINDOWS SERVICE Beautification Let’s add solid borders at the top and bottom of the table1 header As you may notice, we have a CreateDate column with a DateTime data type Please ... =Fields!CreateDate.Value CreateDate Format d CreateDate TextAlign Left CustomerName Value =Fields!CustomerName.Value ComplaintType Value =Fields!ComplaintType.Value table1 DataSetName dsComplaint_dtComplaintList...

Ngày tải lên: 05/10/2013, 08:48

24 379 1
Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt

Tài liệu Managed Investment Funds Product Disclosure Statement - A range of funds that allows you to create an investment portfolio that suits your individual needs ppt

... financial adviser and important additional information about the fees and costs of the product 18 Provides information on establishing and transacting on your account, how you can access information ... Growth Australian shares WW Australian Share WW Imputation WW Geared Share Global shares WW Global Share WW Global Resources WW Global Health & Biotechnology WW Global Technology & Communications ... delivering a borrowed security or settling obligations under a financial contract Legal and regulatory risk This is the risk that any change in taxation, corporate or other relevant laws, regulations or...

Ngày tải lên: 19/02/2014, 09:20

52 578 0
BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

BE GARAGE WISE - Don’t get taken for a ride when you take your car in for a service docx

... carried out within a reasonable time at a reasonable charge (if no charge is agreed in advance); and that any goods supplied must be of satisfactory quality TAKE CHARGE OF YOUR VISIT TO A GARAGE ... AA www.theaa.com Trading Standards Trading Standards services are provided by your local authority For contact details of your local department see your phone book or go to: www.tradingstandards.gov.uk ... replacing, based on the way you use your car TAKE CHARGE OF YOUR VISIT TO A GARAGE CHARGES In the end, it is for you to decide whether the charge a garage makes for parts and servicing is reasonable...

Ngày tải lên: 30/03/2014, 10:20

14 353 0
báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx

báo cáo hóa học: " Is global quality of life reduced before fracture in patients with low-energy wrist or hip fracture? A comparison with matched controls" docx

... limitation emotional Statistical analysis Statistical analysis was carried out using the Statistical Package for Social Sciences (SPSS) for Windows (version 14.0) Demographic and clinical variables ... Cronbach's alpha in our study was 0.87 for the total score, 0.67 for the relationship and marital well-being score, 0.70 for the health and function score, and 0.76 for the personal, social, and ... 56 McLellan AR, Gallacher SJ, Fraser M, McQuillian C: The fracture liaison service: success of a program for the evaluation and management of patients with osteoporotic fracture Osteoporos Int...

Ngày tải lên: 18/06/2014, 19:20

11 526 0
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot

... KS+ (Stratagene) 5'-AGGGCGGGGGCATCGGGCACCGGGATGGCCGCCGCGACGGCCGACGATG AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' ... (5'-cttgctggacgcagagcacta-3') and UL8-r (5'gatttcgcgcaggtgatgag-3') for UL8; and 18S rRNA-f (5'-actcaacacgggaaacctca-3') and 18S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18S rRNA Reactions were performed using ... kinases TGF-beta-activated kinase 1, mitogen-activated kinase/extracellular signal-regulated kinase kinase 1, and I kappa B kinase J Immunol 2003, 170:6224-6233 Saffran HA, Pare JM, Corcoran JA,...

Ngày tải lên: 20/06/2014, 01:20

13 463 0
Báo cáo hóa học: " Global behavior of 1D compressible isentropic Navier-Stokes equations with a non-autonomous external force" docx

Báo cáo hóa học: " Global behavior of 1D compressible isentropic Navier-Stokes equations with a non-autonomous external force" docx

... existence and asymptotic behavior for g = and μ = const with boundary conditions u(0,t) = u(1,t) = 0; Zhang and Fang [17] established the global behavior of the Equations (1.1)-(1.2) with boundary ... et al [12], Fang and Zhang [13,14], Qin et al [15], authors studied the global existence and uniqueness under some assumptions on initial data When f ≠ 0, Qin and Zhao [16] proved the global ... equations; Okada et al [5] obtained the global existence of weak solutions when

Ngày tải lên: 20/06/2014, 22:20

19 550 0
Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx

Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx

... Mart´nez-Finkelshtein, J J Moreno-Balc´ zar, and H Pijeira-Cabrera, “Strong asymptotics for ı a Gegenbauer-Sobolev orthogonal polynomials,” Journal of Computational and Applied Mathematics, vol 81, no ... Jacobi, Laguerre and Hermite expansions,” SIAM Journal on Mathematical Analysis, vol 14, no 4, pp 819–833, 1983 11 M Abramowitz and I A Stegun, Handbook of Mathematical Functions, Dover, New York, ... We call them the Jacobi-Sobolev orthogonal polynomials The measures μα,β and μα 1,β constitute a particular case of the so-called coherent pairs of measures studied in In see also , the authors...

Ngày tải lên: 21/06/2014, 07:20

22 323 0
Báo cáo hóa học: " Research Article Unsupervised Video Shot Detection Using Clustering Ensemble with a Color Global Scale-Invariant Feature Transform Descriptor" ppt

Báo cáo hóa học: " Research Article Unsupervised Video Shot Detection Using Clustering Ensemble with a Color Global Scale-Invariant Feature Transform Descriptor" ppt

... rather than 3D vector values, it saves storage space For example, for any 12-bit color palette (4096 colors) storing R, G, and B values for each color, it needs 12 kilobytes of data for the palette ... 22] and later applied to content-based image retrieval [23] Features extracted by SIFT are invariant to image scale, rotation, and changing viewpoints The algorithm transforms a grayscale image ... and random data splits Fred and Jain [18], based on the idea of evidence accumulation, considered that each partition is viewed as an independent evidence of data organization Individual data...

Ngày tải lên: 22/06/2014, 19:20

10 283 0
Monkey with a PinWhy you may be missing 6% a year on your investment returns pot

Monkey with a PinWhy you may be missing 6% a year on your investment returns pot

... accounts after a short-term bonus rate has expired Data from accounts that no-one uses anymore For building society data, Barclays originally used the average interest rate on an ordinary share ... year by poor skill alone is around –2.2% for fund investors and –1.3% for share investors • The average alpha for a UK fund manager is probably +0.2% • These estimates are largely based on an analysis ... chapter The main increase took place before the private investor had a chance to buy Hard times for US fund investors All of the above data deal with share trading So, what evidence is there for...

Ngày tải lên: 27/06/2014, 23:20

110 388 0
herald  achieving a global event notification service

herald achieving a global event notification service

... Czerwinski, Patrick Eaton, Dennis Geels, Ramakrishna Gummadi, Sean Rhea, Hakim Weatherspoon, Westley Weimer, Chris Wells, and Ben Zhao OceanStore: An Architecture for Global- Scale Persistent Storage In ... explore how well one can manage a global service with such state Equally important will be to understand what the cost of disseminating information in this fashion is It is an open question exactly ... inaccurate information can take us This is in contrast to employing more accurate, but also more expensive, approaches to distributed state management Another area of Internet experience that we plan...

Ngày tải lên: 01/07/2014, 18:22

6 1K 0
Báo cáo y học: "Recently published papers: Take your predictions with a drop of saline … and breathe deeply before turning on your phone" ppt

Báo cáo y học: "Recently published papers: Take your predictions with a drop of saline … and breathe deeply before turning on your phone" ppt

... social workers), and the average response time was a phenomenal 1.7 This figure we find particularly astounding, and reflects Australia’s resurgence as a sporting nation Of particular interest are ... designated ICU nurse Specialist availability was provided on site for 12 hours but was also available after hours if needed Any member of the hospital clinical staff could activate the MET team ... completely have already introduced hardware and software upgrades that remedy the problem However, in the meantime, perhaps we should keep mobile phones and ventilators at a safe distance, or at least...

Ngày tải lên: 12/08/2014, 20:20

3 305 0
DESIGN, DEVELOPMENT AND EXPERIMENTATION OFA DISCOVERY SERVICE WITH MULTI-LEVEL MATCHING

DESIGN, DEVELOPMENT AND EXPERIMENTATION OFA DISCOVERY SERVICE WITH MULTI-LEVEL MATCHING

... Security Manager (DSM), Query Manager (QM), Adapter Manager (AM), and Link Manager (LM) The Domain Security Manager (DSM) is responsible for maintaining the authorization information about all the ... multiple matching mechanisms which contain an attribute and a semantic matching engines which can be categorized as an effort to provide customization on matching at two levels 2.4 Cloud-based matching ... guarantees, and infrastructure related information Figure 3.1 presents the UniFrame Approach (UA) UA’s main aim is to provide means for an automatic or semi-automatic creation of DCS The UA provides...

Ngày tải lên: 24/08/2014, 12:02

101 229 0
Local features to a global view  recognition of occluded objects by spectral matching using pairwise feature relationships

Local features to a global view recognition of occluded objects by spectral matching using pairwise feature relationships

... Combinatorial complexity of graph matching As an approximate solution for graph matching, spectral graph theory is applied to a family of techniques that aims to characterize the global structural ... to calculate matching rate for a matching algorithm 56 Table 3.3 Comparison of matching rates (%) on cars and bicycles datasets .56 Table 3.4 Improvements of matching rates(%) with IPFP a post-processing ... justification for this approach is that the density of features near a given feature in a database is an indication of how discriminatory that feature is A disadvantage of this approach is the...

Ngày tải lên: 09/09/2015, 17:52

171 317 0
Drawing - Fun With A Pencil

Drawing - Fun With A Pencil

... from the tracing, or take any of your own drawings and distort them Here again is a chance for your own invention Draw a square around your subject Divide each way into eight or more parts If you ... we can take as a basic form a ball sliced off at the sides, leaving it a little wider one way than the other, and adding to it or taking some away The forehead may be flattened, cut down, or built ... skull, or make any allowance for the variety of shapes 36 After this book was published, I learned with interest that a similar basic head form has been used for years by Miss E Grace Hanks of...

Ngày tải lên: 13/09/2012, 14:19

123 2K 6
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"

... tuberculate, supplemental and odontome; however, the Literature also reports a classification according to intraoral position of the supernumerary teeth: Mesiodens; Paramolar; Distomolar and Parapremolar ... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without ... investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission of the algic...

Ngày tải lên: 25/10/2012, 11:40

7 598 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"

... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... t-test was performed for comparison of mean scores between groups One-way analysis of variance was used for comparison of means among groups Initially, categories with or without Sarapin in each ... C-fibres Acta Anaesthesiol Scand 1990; 34: 335-8 69 Pasqualucci A, Varrassi G, Braschi A, et al Epidural local anesthetic plus corticosteroid for the treatment of cervical brachial radicular pain:...

Ngày tải lên: 26/10/2012, 09:07

12 670 0
w