maribavir a novel benzimidazole ribonucleoside for the

... demographic and rating data are employed in the propo-sal A novel initialization procedure to create pre-ratings for the Complete Rating Data based on the idea of the most popular rating is attached ... 1) randomly division of this dataset Thefinal accuracies of algorithms are the average results among all divisions of the dataset By the similar calculation, we also obtain the accuracies of algorithms ... ratings of the newuser in the list by the most popular rating of all users based on the histogram of an item The new approximated data are appended to the Complete Rating Data The reason for doing

Ngày tải lên: 14/12/2017, 17:50

... human endothelial cells interacting with artificial materials under dynamic combinations of flow-generated wall shear stress and wall deformation The wall shear stress and wall deformation values ... flow, the wall geometry, and the deformability of the wall materials19 The temporal variations and absolute magnitude of flow-generated wall shear stress (WSS) and wall deformation (WD) showed a ... introduced novel reactor system as a valuable plat-form to test the endothelialization of artificial materials under physiological and supraphysiological conditions of mechanical loading In the reactor,

Ngày tải lên: 19/11/2022, 11:48

... variables (Input and output variables).The necessary data for the analysis was collected as follows The distance matrices, demands of each candidate municipality and hospitals are shown in Appendix ... uncertain data and imprecise knowledge The main advantages of fuzzy AHP are that the consistency ratio can be measured, and, it can apply to both tangible and intangible criteria (Durán & Aguilo, ... disposal municipality Formulate and solve the cost-based transshipment model for IWM to provide candidate alternatives Take the candidate alternatives as DMUs and input-output variables into DEA

Ngày tải lên: 26/05/2020, 22:42

... patients to neoadjuvant therapy with aromatase inhibitors Cancer Res 2010;70(1):319–28 Garcia-Casado Z, Guerrero-Zotano A, Llombart-Cussac A, Calatrava A, Fernandez-Serra A, Ruiz-Simon A, Gavila ... between having at least one CYP1A2 rs762551 C-allele and at least one AhR Arg554Lys A-allele on the risk for early events in AItreated patients was observed Helmig et al reported that the AhR A-allele ... and translational studies of the AhR and CYP1A1/2 signaling pathway with respect to CYP19A1 regulation and AI-response are therefore warranted In the present study, a special focus was placed

Ngày tải lên: 21/09/2020, 09:43

... that for the other approaches the prediction certainty is almost always found at high values Thus, for these approaches there is a smaller performance gain when comparing very certain to average ... Pathoscope2 and Kraken fail to classify the majority of the reads Kraken-16 and BLAST still miss a considerable fraction of reads whereas the machine learning based approaches always return a ... 15 and then scored all test read sets against all training databases For each read, we selected the highest-scoring hit and matched the species name to the label database Since classification

Ngày tải lên: 04/12/2022, 15:55

... (‘interlamellar matrix’), at the boundary of adjacent mature nacre tablets (‘intertabu- lar matrix’), or within the crystallites (‘intracrystalline matrix’). First, the interlamellar matrix is assumed ... network of an organic intracrystal- line phase. Summarizing the different recent advances on molluscan nacre, Addadi et al. [19] have proposed a coherent and dynamic model for nacre formation, as described ... mono- saccharidic composition. The composition of neutral sugars is obtained by HPAE-PAD. Data are represented as ngÆlg )1 of the total matrix and as a percentage of the total identified carbohydrate compounds.

Ngày tải lên: 22/03/2014, 16:20

... with the average molecular mass of His (Table 1) On replacing the unknown amino acids of fragment with His, the theoretical average molecular mass (1365.62 Da) of fragment calculated from the amino-acid ... has been proposed that amphipathic a-helical peptides show antimicrobial activity by interacting electrostatically with the anionic bacterial membrane, adopting an amphipathic a-helical conformation ... M NaCl, except for A hydrophila and E tarda The results indicate that chrysophsins show broad-spectrum bactericidal activity against pathogenic bacteria up to 0.34 M NaCl The bactericidal activity

Ngày tải lên: 23/03/2014, 20:22

... used for the 3-kb 5¢-UTR were 3¢HPLZF (5¢-gaggggaagaagcaaaagaga-3¢) and (+)2878 HPLZF (5¢-gatccggaggctttgtacc-3¢). The primer sequences for the 776-bp region were pPLZF742SmaIA (5¢-tcactacccgggaagcccttgcttccttcatc-3¢) ... (5¢-gaaaggcatcccgaacgcat-3¢); Chip2up primer (5¢-aaatgtcttgaccagccgtc-3¢) and Chip2dw primer (5¢-gaaacaaaggcctctcccag-3¢); Chip3up primer (5¢-gctttgcagt- cagaatggtc-3¢) and Chip3dw primer (5¢-ctgagcactgactac- gaaac-3¢). ... Seattle, WA, USA) that targeted a conserved sequence in rat, mouse and human CUX1 was kindly provided by Dr Julian Downward [50]. Two bases (in capitals) were further mutated (5¢-aagaaga acaGAccagaggattt-3¢)

Ngày tải lên: 29/03/2014, 21:20

... Trang 1A novel phosphorylated glycoprotein in the shell matrix of the oyster Crassostrea nippona Tetsuro Samata, Daisuke Ikeda, Aya Kajikawa, Hideyoshi Sato, Chihiro Nogawa, Daishi Yamada, Ryo ... Yamada, Ryo Yamazaki and Takahiro Akiyama Laboratory of Cell Biology, Faculty of Environmental Health, Azabu University, Sagamihara, Japan Subsequent to the pioneering work of Miyamoto et al [1], ... Fuchinobe, Sagamihara, Kanagawa 229-0006, Japan Fax: +81 42 769 2560 Tel: +81 42 769 2560 E-mail: samata@azabu-u.ac.jp Database The nucleotide sequences have been sub-mitted to DDBJ with the accession

Ngày tải lên: 30/03/2014, 04:20

... Tongaokar P, Vega I, Lambertson D, Potts W & Madura K (1998) Rad23 links DNA repair to the ubiquitin ⁄ proteasome pathway Nature 391, 715–718 Hiyama H, Yokoi M, Masutani C, Sugasawa K, Maekawa ... Kawahara H, Kasahara M, Nishiyama A, Ohsumi K, Goto T, Kishimoto T, Saeki Y, Yokosawa H, Shimbara N, Murata S, et al (2000) Developmentally regulated, alternative splicing of the Rpn10 gene generates ... isoforms: evolutional conservation of the genomic organization in vertebrates Biol Chem 383, 1257–1261 34 Sakata E, Yamaguchi Y, Kurimoto E, Kikuchi J, Yokoyama S, Yamada S, Kawahara H, Yokosawa

Ngày tải lên: 30/03/2014, 11:20

... group and the control group for both the signal representation approach and the signal modelling approach in the univariate and bivariate cases. Once the features were available, classification was ... across the different brain lobes was obtained for the Alpha band (where the highest score of 72.5% was achieved) and the Beta band over the frontal lobe. For the Gamma bands, WT also obtained relatively ... The bar graphs also show that overall the Gamma1 band was consistent, as well. For Task 2, the classification scores are more sporadic than those obtained for Task 1. The most stable result across

Ngày tải lên: 19/06/2014, 08:20

... classifying a vibration signal as an aspiration when a swal-low has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually ... actual swallowsthat are correctly classified as swallows, Lastly, the adjusted accuracy [52], a measure which accounts for unbalanced sample sizes of positive (aspira-tions) and negative (swallows) ... null hypothesis of stationarity, z A is distributed as a standard normal with zero mean and unit variance Hence, at the 5% significance level, |z A| < 1.96 for a sta-tionary signal For a step-by-step

Ngày tải lên: 19/06/2014, 10:20

... vibration analyser generates the excitation signal which is amplified and sent to the shaker The vibration analyser, the portable computer and the amplifier were installed in the surgical theatre ... vibration analysis technique was used for the mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration ... all authors All authors read and approved the final man-uscript Appendix The intra-operatively manufactured prosthesis In the IMP-procedure, the stem of the prosthesis is custom made for each

Ngày tải lên: 20/06/2014, 01:20

... (+) CACGACGTTGTAAAACGACG pG1825(-) CACAGGAAACAGCTATGACC 579 (+) GATGTTACTCGTGGATCTGG 1141 (+) CATGATCAACTGCTCTGATTAC 1741(+) GGGCTTCCCGTACTTTGTG 2321(+) TGGATTTAGCTCCCTGAATG TYLCV primers for ... (176 bp amplicon) Ty 2164+ CTAAGAGCCTCTGACTTACTGC 200 nM Ty 2339- AACATTCAGGGAGCTAAATCCAG 200 nM Actin2 gene primers for Q-PCR (148 bp amplicon) Act 148- TMCGRTCAGCAATACCAGGG 200 nM Trang 9The youngest ... pGreen (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CG C C TTT

Ngày tải lên: 20/06/2014, 01:20

... to the 3GPP-LTE specifications for a typical urban area. Trang 7According to the 3GPP-LTE system, the eNode-B is theone that for each TTI (in our case channel realization) acquires the data about ... typical case for the urban area was utilized for this purpose The time delay and the corresponding average powers in the case of a 12 tap configuration are shown in Table 2 The 3GPP-LTE normative ... the lower bound In this regard, although it may seem that the search tree algorithmand the PBHM could have a similar perfor-mance, a very important aspect to consider is that in the case of the

Ngày tải lên: 21/06/2014, 00:20

... Zhang et al [4] used an approach which takes advantage of the users by selecting an area of interest in the image The selected part of the image is then recognized and translated, with the transla-tion ... reader for the blind The K-NFB Reader [2] is the most comparable device in terms of functions and technical approach Combining a digital camera with a personal data assistant, this technical aid ... color spaces as Abadpour and Kasaei [14] who used a PCA-based fast segmentation method for color spotting Garcia and Apostolidis [15] exploited a char-acter enhancement based on several frames of

Ngày tải lên: 22/06/2014, 19:20

... nonlinear operator equation in an abstract separable HilbertH or Banach H1space Then, after some manipulations, we bring the linear operator equation into the form whereu ∈ H is the unknown variable, ... method, the linear or nonlinear difference equation under consideration is transformed equivalently into a linear or nonlinear operator equation defined in an abstract Hilbert spaceH or Banach spaceH1, ... The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial difference equations of p variables in the Hilbert space
2

Ngày tải lên: 23/06/2014, 00:20

... HTLV-4 are associated with any particular disease such as leukemia The amino acid sequence and the functional analysis of HTLV-3 Tax3 showed that Tax3 has a functional PBM, and is capable of interacting ... 80 80 Transformation (Number) 60 40 20 40 20 Tax 224 Tax 232 Tax Tax 300 Tax2B Tax2B Tax 207 Tax300 D) Tax 154 Tax232 Tax1 Tax224 Tax 207 Tax207 Tax 184 Tax184 Tax154 Tax1 Tax1 Tax 154 Tax207 B) ... region plays a crucial role in the increased transforming activity seen with Tax1 relative to Tax2, mostly through the activation of the noncanonical NF-κB/p100 pathway Taking into account the fact...

Ngày tải lên: 12/08/2014, 23:22

... where m = for Case and m = for Case The interval enclosures for all state variables and the initial approximations xapp,1 (t) and xapp,2 (t) are shown in Fig In the considered time span, the improved ... they are fairly efficient for exactly known initial states and parameters, they are sometimes insufficient for practical scenarios with uncertain but bounded initial states and parameters which have ... 2 the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated...

Ngày tải lên: 12/01/2014, 22:04

... estimate for calculating the limit of detection (LOD) of analytical methods MasterScan: a database of shotgun mass spectra The MasterScan is a flat file database that stores all mass spectra acquired ... available for testing local installations of the software LipidXplorer benchmarking: the dataset E coli total lipid extract was purchased from Avanti Polar Lipids (Alabaster, AL, USA) and analyzed ... some peaks might only appear in a few samples, while being fully undetectable in others Also, the available algorithms for aligning mass spectra are not time-linear and are hardly applicable for...

Ngày tải lên: 09/08/2014, 22:23