... the particular health conditions of the countries it serves Member States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Czech Republic Denmark ... Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Netherlands Norway Poland Portugal Republic ... information and data so that they can make informed decisions to prevent harm Nationally collected data can be compared with international norms and standards to ensure that public health is at...
Ngày tải lên: 16/03/2014, 14:20
... Slovakia a TFYR Macedonia Hungary Croatia Bulgaria Kazakhstan Georgia Turkmenistan Albania Romania Azerbaijan Belarus Armenia Republic of Moldova Kyrgyzstan Uzbekistan 50 100 150 200 250 300 Availability ... Estonia Norway United Kingdom Poland Italy Romania Czech Republic Malta Denmark Latvia Portugal Ukraine Slovenia Bulgaria Russian Federation Slovakia Kyrgyzstan Spain Kazakhstan Turkmenistan Hungary ... tropical-plant fat and oil, are also strong stimulators for raising LDL levels, as are some transfatty acids (49) A major saturated fat, stearic acid, present in beef fat and lard, a 300 Men 200 100 Deaths...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: "A Logical Basis for the D Combinator and Normal Form in CCG" pptx
... Combinatory Categorial Grammar In Proceedings of EMNLP-2006 Mark Steedman and Jason Baldridge To Appear Combinatory Categorial Grammar In Borsley and Börjars (Borsley and Börjars, To Appear) Mark ... Motivation for D CCG is only partially associative Here, we discuss several situations which require greater associativity and thus cannot be given an adequate analysis with CCG as standardly ... Finally, the unary combinator basis for CCG provides an interesting additional specification for generating CCG rules Like the CTL basis, the unary combinator basis can produce a much wider range...
Ngày tải lên: 31/03/2014, 00:20
Báo cáo khoa học: A structural basis for the pH-dependence of cofilin F-actin interactions potx
... parameters (apparent dissociation constant Kd and the maximal binding Amax) were determined by non linear fitting A ¼ Amax · [L]/ (Kd + [L]) where A is the absorbance at 405 nm and L the ligand ... the assembly of the head of bacteriophage T4 Nature 227, 680–685 43 Ogawa, K., Tashima, M., Yumato, Y., Okuda, T., Sawada, H., Okuma, M & Maruyama, Y (1990) Coding sequence of human placenta cofilin ... 3007.3007.12 Hatanaka, H., Ogura, K., Moriyama, M., Ichikawa, S., Yahara, I & Inagaki, F (1996) Tertiay structure of destrin and structural similarity between two actin-regulating protein families...
Ngày tải lên: 31/03/2014, 09:20
báo cáo hóa học: " Primary glia expressing the G93A-SOD1 mutation present a neuroinflammatory phenotype and provide a cellular system for studies of glial inflammation" potx
... thank the Oklahoma Medical Research Imaging Core Facility for their assistance and Mrs Marilyn Bonham-Leyba for assistance with manuscript preparation References 10 Pramatarova A, Laganiere J, Roussel ... commercially available enzyme linked immunosorbent assays (ELISAs; Cayman Chemical, San Diego CA USA) Nitrite assay Cell culture medium was assayed for NO2- by the Griess assay as described [8] Samples ... the labeled samples) Curiously, no major protein carbonylation band assignable to SOD1 was found in any G9 3A- SOD1 astrocyte lysates whereas a major carbonylated protein identifiable as SOD1 was...
Ngày tải lên: 19/06/2014, 22:20
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy
... Laboratories, PA, USA) The following primers were used: HSVtk, 5'-CCCATATCGGGGACACGTTATTT3' (forward) and 5'-GATAAAGACGTGCATGGAACGGAG-3' 5'-CCTGGATGCCGAACAAGGTTTA-3' (forward) CCAGCGTTCAATGCCTTCAAAC-3' TGGTGTTCCTATTGGCGGATGTCT ... GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA -3’ (reverse), size:1.2kb; Fcy 5’-AGGAATTCATGGTGACAGGGGGAATG -3’ (forward) and 5’- CCGCTCGAGCTACTCACCAATATCTTCA -3’ (reverse), ... Timothy Kwang, Dang Hoang Lam, Jiakai Lin, Seong Loong Lo, Yovita Ida Purwanti, Chrishan Julian Alles Ramachandra, Mohammad Shahbazi, Chunxiao Wu, Kai Ye, Ying Zhao, Jieming Zeng and Detu Zhu have...
Ngày tải lên: 09/09/2015, 18:56
Human embryonic stem cells as a cellular model for osteogenesis in implant testing and drug discovery
... OCT4 F: CGRGAAGCTGGAGGAGAAGGAGAAGCTG 55 oC R: AAGGGCCGCAGCTTACACATGTTC NANOG F: GGCAAACAACCCACTTCTGC 55 oC R: TGTTCCAGGCCTGATTGTTC β-ACTIN F: ACAGAGCCTCGCCTTTGCC 58 oC R: ACATGCCGGAGCCGTTGTC 2.1.5 ... transplanted into autologous or allogeneic host safely and effectively[19] In earlier this year, donor derived brain tumor after neural stem cell transplantation for ataxia telangiectasia was ... undergo malignant transformation after more than month passaging even in in vitro studies [21] Currently, there is still lack of a universal standard for the nomenclature and characterization of adult...
Ngày tải lên: 16/10/2015, 15:38
Breathlessness A Physiological Basis For Discussion
... implies a bank of experience in which “appropriate” information is stored “We get used to things” “inappropriate”, if a chronic state, becomes “acceptably” appropriate temporal adaptation (nasal fatigue) ... 80 A clinical analysis of breathlessness implies seeking answers to; Clinical evidence of load or drive abnormality? Appropriate investigations to confirm this An explanation in terms of causation ... Breathless Heart aches, Lungs pant, The dry air Sorry, scant Legs lift And why at all? Loose drift, Heavy fall Prod the snow, Its easiest way: A flat step Is holiday ********** **********...
Ngày tải lên: 16/10/2015, 16:42
Báo cáo y học: "Cellular metabolism as a basis for immune privilege" pps
... PE-conjugated anti-mouse Fas (CD95) antibodies (Pharmingen, California) and measured using a Coulter Elite Epics Flow Cytometer (Coulter, Hialeah, Florida) and FlowJo analysis software (Tree Star, ... fluorochromes varies with time, this makes direct statistical comparisons suspect The level of Fas was detected using PE-conjugated antihumanFas (CD95) antibodies (Pharmingen, California) and measured ... Extending the Danger model, we suggest a change in metabolism can lead to a change (either an increase or a decrease) in the number of free radicals in the cell and this, in turn, leads to a change in...
Ngày tải lên: 11/08/2014, 10:23
Epigenetic control of neuronal activity dependent gene transcription as a basis for long term memory formation
... that eventually lead to memory consolidation in a temporally defined manner Much like how the cellular correlate of memory, Long Term Potentiation, has an early and a late phase, which parallels ... and Caroline Wee, for holding me by the hand when I was first trying to walk (aka run gels), Rajaram Ezhilarasan for the hard work and dedication, Niamh Higgins, Knvul Sheikh, Annabel Tan, Gokul ... for all forms of LTP and LTD: early Arc synthesis is required for early LTP expression, whereas sustained Arc synthesis is needed for late-phase LTP maintenance52,53; on the other hand, Arc is also...
Ngày tải lên: 09/09/2015, 08:13
Social factors as a basis for treatment
... frequency of hospitalisation (McGurk and Mueser, 2003; Sengupta et al., 1998) 167 Social factors as a basis for treatment Integration of vocational rehabilitation and mental health services Supported ... increased demand for inpatient psychiatric care (Abas et al., 2003), and, while poverty and substance abuse are not necessarily related, poverty often increases the degree of harm that occurs at any ... each year In 1976, Fountain House launched a national training programme and in 1988, a national expansion effort The International Center for Clubhouse Development was established in 1994, launching...
Ngày tải lên: 01/11/2013, 09:20
Tài liệu Báo cáo khoa học: Properties of ecdysteroid receptors from diverse insect species in a heterologous cell culture system – a basis for screening novel insecticidal candidates docx
... on the aromatic moiety of dibenzoylhydrazines on larvicidal activity against the Colorado potato beetle Leptinotarsa decemlineata Pest Manag Sci 57, 858–865 Nakagawa Y, Minakuchi C, Takahashi K ... receptor-mediated transcriptional activity in CHO cells over a dosage range (A) DmEcRB2 (B) LdEcRA (C) LdEcRB All luciferase activity levels were normalized on the basis of b-galactosidase activity as a ... LdEcRA ORF was isolated by PCR from pBluescriptKS + LdEcRA [31], using the forward primer 5¢-TTTT GGATCC ACC ATG ACC ACC ATA CAC TCG ATC-3¢ and the reverse primer TCTAGA CTA TGT CTT CAT GTC GAC...
Ngày tải lên: 18/02/2014, 08:20
Đề tài " A five element basis for the uncountable linear orders " doc
... supercompact cardinal We will often appeal to the bounded form of this axiom isolated by Goldstern and Shelah [9] We will use an equivalent formulation due to Bagaria [2]: BPFA: If φ is a formula in ... ω1 , C and C ∗ form a five element basis for the uncountable linear orders whenever X is a set of reals of cardinality ℵ1 and C is a Countryman line Notice that by our observations such a basis ... X is a set of reals of cardinality ℵ1 , then X serves as a single-element basis for the class of uncountable separable linear orders PFA is a strengthening of the Baire Category Theorem and is...
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: Investigations into the ability of an oblique a-helical template to provide the basis for design of an antimicrobial anionic amphiphilic peptide pot
... multicellular organisms Nature 415, 389395 43 Sospedra P, Espina M, Gomara MJ, Alsina MA, Haro I & Mestres C (2001) Study at the air water interface of a hepatitis A N-acetylated and C-amidated ... the apolar face of the AP1 a- helix, and previous studies have shown that similarly located glutamate residues are important for the antimicrobial action of other a- AMPs also predicted to form an ... Moffat, National Research Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a...
Ngày tải lên: 07/03/2014, 12:20
Global Guidance PrinciPles for life cycle assessment databases: A Basis for Greener Processes and Products ppt
... prepararon artớculos temỏticos para cada 21 ỏrea y la informaciún previamente publicada fue extraớda y colocada en una base de datos para la preparaciún de dichos artớculos y para su consulta durante ... data users, is important because data move from raw state to and through datasets and databases User feedback Networking of databases Data in the supply chain Raw data collection Database management ... bỳsqueda intensa de datos miner a de datos-para avanzar hacia un mundo bases de datos interconectadas y una accesibilidad total a datos confiables La construcciún de capacidades es particularmente...
Ngày tải lên: 07/03/2014, 23:20
Báo cáo khoa học: "A BASIS FOR A FORMALIZATION OF LINGUISTIC STYLE" pot
... Computational stylistics for natural language translation PhD thesis, University of Toronto DiMaxco, Chrysanne and Hirst, Graeme (1992) "A computational approach to style in language." Manuscript ... submitted for publication Halliday, Michael (1985) An introduction to functional grammar Edward Arnold Halliday, Michael and Hasan, Ruqaiya (1976) Cohesion in English Longman Hovy, Eduaxd H (1988) ... (1988) Generating natural language under pragmatic constraints Lawrence Edbaum Associates Quirk, Randolph, Greenbaum, Sidney, Leech, Geoffrey, and Svartvik, Jan (1985) A comprehensive grammar of the...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo khoa học: Molecular basis for substrate recognition and drug ˚ resistance from 1.1 to 1.6 A resolution crystal structures of HIV-1 protease mutants with substrate analogs pptx
... Georgia Research Alliance We thank the staff at the SER-CAT beamline at the Advanced Photon Source, Argonne National Laboratory, and at the beamline X26C of the National Synchrotron Light Source at ... protease variant: structural insights for better antiviral therapy J Virol 77, 1306–1315 Prabu-Jeyabalan M, Nalivaika EA, King NM & Schiffer CA (2004) Structural basis for coevolution of a human ... substrate analogs Phe-Glu-Ala-Nle-amide, L6525; Sigma-Aldrich), which is an analog of the CA-p2 cleavage site The assay solution contained 50 mm sodium acetate, pH 5.0, 0.1 m NaCl and mm EDTA The...
Ngày tải lên: 30/03/2014, 20:20
báo cáo hóa học: " A radial basis classifier for the automatic detection of aspiration in children with dysphagia" doc
... vibration signal as an aspiration when a swallow has actually occurred, whereas a false negative (FN) is the event of classifying a vibration signal as a swallow when an aspiration has actually occurred ... saturation of the basis functions The gaussian radial basis function was selected for its proven approximation capabilities The number of radial basis units was increased as necessary during training ... Aspiration classifier The proposed feature combinations and radial basis classifier achieved approximately 80% adjusted accuracy in classifying aspirations and swallows This accuracy level already exceeds...
Ngày tải lên: 19/06/2014, 10:20
báo cáo hóa học: " Elimination kinetics of diisocyanates after specific inhalative challenges in humans: mass spectrometry analysis, as a basis for biomonitoring strategies" doc
... like mercapturic acid, glucoronic acid as well as acetyl-/diacetyl isocyanate diamines to corresponding MDA, HDA, TDA, NDA and IPDA For the current analysis, all patient samples, standards and controls ... estimated with standard curves for each individual isocyanate-amines’ run in parallel Analytical standards for each individual diamine were used to prepare standard Page of calibration curves (7 ... elimination time patterns for the individual isocyanate diamines The data analyses were performed with GraphPAD Prism-Software (GraphPad Software Inc., San Diego, CA) Results The median values calculated...
Ngày tải lên: 20/06/2014, 00:20