lt jsp include gt an example 1
LT PHƯƠNG TRÌNH CHỨA ẨN Ở MẪU
... + ( x − 3) ( 3x + 1) (2)↔ ( 3x + 1) ( x + 3) = ( 3x + 1) ( x + ) ( 3x + 1) ( x + 3) → 3x - 11 – 4(3 - x) = - →(3x - 1) (x + 3)+(x – 3)(3x + 1) = 2(3x + 1) (x + 3) ↔ 3x - 11 - 12 + 4x = - ↔ 3x2 ... MẪU 1. Giải phương trình chứa ẩn mẫu đưa phương trình bậc ẩn a) x − 11 −4= (1) 3− x x −3 ĐKXĐ: x ≠ 3 x − 11 − ( − x (1) ↔ − x ) = − − x b ) 3x − x − + = 3x + x + ĐKXĐ: x ≠ - 3; x ≠ - 1/ 3 ( 3x − 1) ... (4) 1 + = x + + 2x2 + x x ⇒ x2 + x = ⇔ ⇔ x(2 x + 1) = ⇔ x (2 x + 1) = x = ⇔ 2 x + = x2 = ⇔ 2 x + = x = ⇔ x = 1 x = ⇔ x = 1 Vậy tập nghiệm phương trình (4) là: S = {0; -1/ 2}...
Ngày tải lên: 07/06/2013, 01:25
THE INFORMAL SECTOR IN SOLID WASTE MANAGEMENT IN DEVELOPING COUNTRIES SUSTAINABILITY EFFECTS OF FORMALISATION CONSIDERING HO CHI MINH CITY – VIETNAM AS AN EXAMPLE
... data can be found in Appendix III Qantity of MSW (19 92 - 2003) 2,500,000 2,000,000 1, 500,000 [t/y] 1, 000,000 500,000 Domestic Solid waste 2003 2002 20 01 2000 19 99 19 98 19 97 19 96 19 95 19 94 19 93 19 92 ... 1, 066,272 1, 172,958 1, 369,358 1, 568,477 1, 662,849 Year 19 95 19 96 19 97 19 98 19 99 2000 20 01 2002 2003 Population (**) 4,640,400 4,747,900 4,852,300 4,957,300 5,073 ,10 0 5,226 ,10 0 5,378 ,10 0 5,479,000 ... 213 19 0 203 223 3 51 500 3 41 330 600 319 308 700 296 800 [m t/y] [m inhabitants] 200 MSW per Capita Municipal Solid Waste 2 010 2009 2008 2007 2006 2005 2004 2003 2002 20 01 2000 19 99 19 98 19 97 10 0...
Ngày tải lên: 24/08/2013, 18:48
Tài liệu An Example of Using the Get* Methods phần 1 pdf
... you can get it using Visual Studio NET's Server Explorer For example, Figure 9 .1 shows the details of the ProductID column of the Products table As you can see, ProductID is an int Figure 9 .1: ... unitPrice = 18 unitsInStock = 39 discontinued = False productID = productName = Chang unitPrice = 19 unitsInStock = 17 discontinued = False productID = productName = Aniseed Syrup unitPrice = 10 unitsInStock ... "server=localhost;database=Northwind;uid=sa;pwd=sa" ); SqlCommand mySqlCommand = mySqlConnection.CreateCommand(); mySqlCommand.CommandText = "SELECT TOP ProductID, ProductName, UnitPrice, " +...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu An Example of Using the Get* Methods phần 2 docx
... unitPrice = 18 unitsInStock = 39 discontinued = False productID = productName = Chang unitPrice = 19 unitsInStock = 17 discontinued = False productID = productName = Aniseed Syrup unitPrice = 10 unitsInStock ... UnitsInStock smallint GetSqlInt16() SqlInt16 Discontinued bit GetSqlBoolean() SqlBoolean Let's assume that you already have a SqlDataReader object named productsSqlDataReader and it may be used to read ... methods shown in Table 9.7 An Example of Using the GetSql* Methods Let's take a look at an example that reads the ProductID, ProductName, UnitPrice, UnitsInStock, and Discontinued columns from...
Ngày tải lên: 24/12/2013, 01:17
Tài liệu An Example—Customer Maintenance pptx
... { if (checkTitleAndGender()) 10 { 11 // Save the current customer's details 12 MessageBox.Show("Customer saved", "Saved"); 13 } 14 else 15 { 16 MessageBox.Show("Customer title and gender are inconsistent" ... checkTitleAndGender() { if (title.Text == "Mr") 10 { 11 // Check that gender is Male 12 if (!male.Checked) 13 { 14 MessageBox.Show("If the title is Mr the gender must be male", "Error", 15 MessageBoxButtons.OK, ... checkTitleAndGender() { if (title.Text == "Mr") { 10 // Check that gender is Male 11 if (!male.Checked) 12 { 13 errorProvider.SetError(gender, "If the title is Mr " + 14 "the gender must be male"); 15 ...
Ngày tải lên: 26/01/2014, 12:20
Tài liệu An Example of Communal Currency pdf
... Notes of 1, 1, 500 of which should be payable on 15 th April, 18 17, or any Saturday after by the Receiver of the Duty, 1, 250 on 15 th October, 18 17, and 1, 250 on 15 th April, 18 18 "In this manner, ... better than bad coin." Notwithstanding the decision of the States in 18 26, the three Jurats, Josias le Marchant, James Carey and Jean le Marchant were still uneasy, and on 10 th April, 18 29, complained ... Market and Finance Committees, 5,000 1 Notes are issued to pay off the £5,000 originally paid for the Market in 18 17 (see p 11 ) "By this means the interest of £200 (sic) a year will be saved and...
Ngày tải lên: 17/02/2014, 19:20
Tài liệu Báo cáo khoa học: "Sentence-For-Sentence Translation: An Example" ppt
... by default SENTENCE-FOR-SENTENCE TRANSLATION An application of the structural transfer routine and the statement of structural equivalence to the analysis presented in Figures 10 and 12 to produce ... the-merchants the-Egyptian.' After syntactic analysis the computer translation reads 'these Egyptian merchants meet the Chinese minister there.' The Syntactic Analysis The syntactic analysis ... (Flow Chart 4) to the translation of the input sentence in Figures 10 and 12 The complete production of the output sentence is presented in Figure 13 and in outline in Figure 11 Since fifty-one rules...
Ngày tải lên: 19/02/2014, 19:20
Writing a Business Plan: An Example for a Small Premium Winery potx
... States 19 89 799 95 1, 573 19 90 807 10 7 1, 610 19 91 827 10 7 1, 623 19 92 845 10 3 1, 648 19 93 866 10 7 1, 683 19 94 922 10 6 1, 772 19 95 944 10 8 1, 820 19 96 877 10 9 1, 755 19 97 1, 011 11 3 1, 988 19 98 1, 185 11 9 2,338 ... 39,977 16 ,488 5,347 8 ,19 2 2, 319 13 ,13 2 19 , 914 14 ,260 14 6 ,17 5 9,275 884 ,11 5 Year 7+ $ 248, 418 $ 2 51, 630 $ 14 1,094 $ 48,632 $ 16 ,9 91 $ 5, 510 $ 8,442 $ 2,389 $ 13 ,532 $ $ 22,005 $ $ 14 ,705 $ 14 1 ,14 4 ... $13 ,13 2 $0 $19 , 914 $0 $14 ,260 $14 6 ,17 5 $9,275 $884 ,11 5 $19 5,648 ($42,700) $14 6 ,17 5 $299 ,12 3 $ 417 ,2 91 ($44,4 81) $14 1 ,14 4 $ 513 ,954 ($237,235) ($202,544) ($ 210 ,475) $224, 712 $303, 816 $ 315 , 713 ($45,345)...
Ngày tải lên: 15/03/2014, 21:20
gabon an example for all of africa
... timber, and manganese Themajor imports are foodstuffs, chemical products, and petroleum products The major partnersfor imports are France and other African countries (World Fact Book, 19 95) The ... andexpansion of its agriculture section has allowed Gabon to grow economically (Call and Post(Cincinnati) 12 /1/ 94 pp.PG.) Gabon exports much of its natural wealth The United states and France are the majortrading ... Government, 19 96 pg 14 6) Yet another reason for Gabon's success is its economy Gabon is an oil-rich country Oil accounts for 80% of their exports Besides petroleum, substantial timber resources andexpansion...
Ngày tải lên: 21/03/2014, 22:02
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... FW1Vj CDR1Vj FW3Vj Kon (M )1 s )1) SE (Kon) Koff (s )1) SE (Koff) KD (M) 7.00 · 10 4 4.93 · 10 5 6.35 · 10 5 1. 7 · 10 3 3.9 · 10 3 8.3 · 10 3 1. 28 · 10 )2 8.25 · 10 )3 6.63 · 10 )4 1. 2 · 10 )4 9.0 · 10 )5 1. 3 ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Inhibitory activity of double-sequence analogues of trypsin inhibitor SFTI-1 from sunflower seeds: an example of peptide splicing docx
... Ka [M )1] Number Analogue SFTI -1 (wild) [6,7] SFTI-1a [6,7] [Abu3 ,11 ]SFTI -1 [6,7] [Phe5]SFTI -1 [10 ] [KK]BiSFTI -1 [FF]BiSFTI -1 [KF]BiSFTI -1 [FK]BiSFTI -1 Trypsin 1. 1 · 10 10 9.9 · 10 9 4.6 · 10 9 (4.4 ... · 10 8 Chymotrypsin 5.2 4.9 1. 8 2.0 (1. 6 (8.7 (2.6 ± 0.2) · 10 8 (1. 2 ± 0.2) · 10 10 (Ch) (5.3 ND (3.0 (1. 3 · 10 6 · 10 6 · 10 6 · 10 9 ± 0.2) · 10 8 ± ± ± ± 0.2) 0.2) 0.4) 0.3) · · · · 10 8 10 9 (T) 10 8 ... b-trypsin and (B) a mixture of b-trypsin and [KK]BiSFTI -1 (5) 10 + 2523.52 01 1.0 B 10 + 2678. 616 0 A Intens x108 0.8 2.0 0.6 0.4 0.2 0.0 [Phe5 ]SFTI -1- chymotrypsin complex 11 + 2294 .14 91 2000 210 0 2200...
Ngày tải lên: 29/03/2014, 09:20
Heinrich event 1: an example of dynamical ice-sheet reaction to oceanic changes ppt
... Sci Rev., 29, 17 91 18 00, doi :10 .10 16/j.quascirev.2 010 .03. 014 , 2 010 Levermann, A., Griesel, A., Hofmann, M., Montoya, M., and Rahmstorf, S.: Dynamic sea level changes following changes in the thermohaline ... Planet Change, 76, 12 8 13 6, doi :10 .10 16/j.gloplacha.2 010 .12 .004, 2 010 a ´ Alvarez-Solas, J., Charbit, S., Ritz, C., Paillard, D., Ramstein, G., and Dumas, C.: Links between ocean temperature and ... oceanic changes s l rate (mm/yr) Absolute time (yr) -17 000 -16 000 1. 95 -15 000 Labrador Sea Mean basal melting Subsurface temperature anomaly 0.00 1. 89 0.47 bm (m/yr) ∆T(°K) -19 000 -18 000 13 03...
Ngày tải lên: 30/03/2014, 16:20
Analyse criterias when there is an m and a and take a company that you know as an example to analyse your criterias analyses
... Finland for 17 0 Microsoft Corporation is an American multinational corporation million euros headquartered in Redmond , Washington Growth •Development skype •Renowned for quality skype call and ... Offering a greater range of product and services Reducing cost and cost efficient • In a merger ,two organizations or companies join together to become a new business • In an acquisition: one ... capital Improve market reach and industry visibility Create strange bedfellows, also have an impact on the bottom line Identify, share and discuss opportunities and problems with employees genes...
Ngày tải lên: 08/05/2014, 17:42
báo cáo sinh học:" Network-based social capital and capacity-building programs: an example from Ethiopia" pdf
... component + isolates Mean: 3.52 Mean: 14 .22 SD: 3 .11 SD: 10 .87 Mean: 1. 87 Mean: 8 .14 SD: 2.88 SD: 10 . 81 Mean: 1. 87 Mean: 8 .14 SD: 1. 77 SD: 5.68 Mean: 1. 04 Mean: 8.26 SD: 1. 46 SD: 5.82 Individual-level ... Observed X2 12 3. 61* * Trainee out-degree Key: ~ < 0 .10 , * p < 0.05, ** p < 0. 01, *** p < 0.0 01 26 .11 Ramanadhan et al Human Resources for Health 2 010 , 8 :17 http://www.human-resources-health.com/content/8 /1/ 17 ... February 2 010 Accepted: July 2 010 Published: July 2 010 © 2 010 RamanadhanHealth http://www.human-resources-health.com/content/8 /1/ 17 This is an Open Access from:2 010 , 8 :17 under the Ltd of the...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx
... 666 9 81 1 .11 8 1. 097 1. 132 1. 137 -.868 1. 133 1. 063 1. 156 1. 176 496 1. 162 8 21 -.358 -.7 41 -.760 636 847 -.882 1. 184 735 1. 143 673 1. 122 1. 284 -.499 -.76 1. 411 -.549 82 -.748 666 -.409 664 1. 082 ... 826 997 870 666 9 81 1 .11 8 1. 097 1. 132 1. 137 1. 18 1. 133 1. 063 1. 156 1. 176 1. 128 1. 162 8 21 1.287 1. 00 1. 23 1. 28 847 9 31 1 .18 4 735 1. 143 1. 15 1. 122 1. 284 1. 03 0 0 0 0 0 0 0 0 2 2 5 2 5 2 5 People as ... 34 1. 05 85 1. 20 95 1. 20 1. 04 1. 20 Psychosocial Loss - .13 40 Eigenvalues - .14 12 13 16 1. 86 19 2.05 20 79 22 1. 27 2.25 36 37 2 .14 2.63 Physical Changes 09 10 11 12 13 14 15 16 17 18 19 20 21 22...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" Assessing normative cut points through differential item functioning analysis: An example from the adaptation of the Middlesex Elderly Assessment of Mental State (MEAMS) for use as a cognitive screening test in Turkey" docx
... 91. 7 10 0 91. 7 10 0 10 0 10 0 10 0 10 0 10 0 10 0 10 0 24 10 0 96.9 10 0 96.9 10 0 93.8 10 0 10 0 10 0 10 0 10 0 10 0 32 72.4 86.2 10 0 58.6 10 0 82.8 10 0 10 0 93 .1 96.6 10 0 10 0 29 10 0 89.7 10 0 89.7 10 0 96.6 86.2 10 0 ... 89.7 89.7 10 0 10 0 29 91. 2 97 .1 100 97 .1 100 97 .1 94 .1 100 10 0 10 0 10 0 10 0 34 83.9 67.7 10 0 93.5 96.8 90.3 93.5 10 0 77.4 90.3 90.3 10 0 31 84.0 92.0 10 0 10 0 10 0 96.0 88.0 10 0 80.0 10 0 10 0 10 0 25 88.6 ... 10 0 25 88.6 88.6 10 0 10 0 10 0 10 0 10 0 10 0 94.3 10 0 10 0 10 0 35 84 .1 79.5 10 0 95.5 93.2 86.4 93.2 10 0 93.2 97.7 97.7 95.5 44 89.5 84.2 10 0 94.7 10 0 89.5 84.2 10 0 89.5 89.5 10 0 10 0 19 Educational Level...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Cross-diagnostic validity in a generic instrument: an example from the Functional Independence Measure in Scandinavia" docx
... 10 11 12 13 14 15 16 17 18 19 20 21 -4,83 -3,67 -2,88 -2,35 -1, 95 -1, 61 -1, 31 -1, 04 -0,78 -0,54 -0,3 -0,07 0 ,17 0,42 0,68 0,96 1, 27 1, 62 2,04 2,55 3,24 4 ,16 -5 -4,07 -3,35 -2,8 -2,32 -1, 89 -1, 5 ... -1, 89 -1, 5 -1, 13 -0,79 -0,48 -0 ,19 0,08 0,35 0, 61 0,89 1, 17 1, 48 1, 83 2,23 2,75 3,5 4,58 -5,35 -4 ,14 -3, 31 -2,73 -2,27 -1, 88 -1, 53 -1, 2 -0,89 -0,59 -0, 31 -0,03 0,25 0,53 0, 81 1 ,11 1, 44 1, 81 2,23 2,76 ... 2 11 Dressing upper body Dressing lower body Loc Number of categories Misfit 3 3 5 3 12 Bladder Bowel Transfer bed Pooled data STR + TBI Loc Number of categories 3 2 10 12 12 12 11 11 11 11 10 ...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Reliability of 95% confidence interval revealed by expected quality-of-life scores: an example of nasopharyngeal carcinoma patients after radiotherapy using EORTC QLQ-C 30" pdf
... 0.25 0 .18 1. 01 0. 91 23 Did you feel irritable? -0 .11 0 .17 0.88 1. 1 13 Have you lacked appetite? -0 .14 0 .17 0.88 1. 19 Do you need to stay in bed or a chair during the day? -0 .17 0 .17 1. 16 1. 1 Trouble ... 2.4 0. 31 1.60 1. 21 Do you have any trouble taking a short walk outside of the house? 1. 45 0.23 1. 04 0.85 15 Have you vomited? 1. 15 0. 21 1. 61 1.2 17 Have you had diarrhea? 0.97 0. 21 1 .17 0.93 ... -0.84 0 .15 0.49 1. 13 12 Have you felt weak? -0.99 0 .15 0. 41 1.26 28 Physical condition or medical treatment caused you financial difficulties? -1. 02 0 .15 1. 74 1. 09 18 Were you tired? -1. 08 0 .15 0.49...
Ngày tải lên: 20/06/2014, 16:20