linq and c 30

... seems to get a class new methods • Past the syntactic sugar it is all about Standard Trang 30Linq under the covers• Compiler creates code similar to Match[] matches = MatchService.GetMatches(); IEnumerable<Team> ... objects can be saved, discarded or accepted Trang 26Notifying changes• UI and object graphs have to keep in sync with changes, inserts and deletes • Achieved with implementations of interfaces: ... m.HomeTeam, m.AwayTeam Descending Select m Trang 5Linq projectLanguages Linq to DataSetsStandard Query Operators C# 3.0 VB 9.0 Other Linq to Entities Linq to XML Linq to Objects Linq to SQL Trang 6[

Ngày tải lên: 14/03/2014, 20:20

... model," and -1 for "the target is an 80186 processor." Here are the actual commands: bcc -c -v -ml -1 led.c bcc -c -v -ml -1 blink.c Of course, these commands will work only if the bcc.exe ... microcomputer age and brought microprocessors into every part of our personal and professional lives Many of the electronic devices in our kitchens (bread machines, food processors, and microwave ... platform and produces code for another-is called a cross-compiler The use of a cross-compiler is one of the defining features of embedded software development The GNU C/C++ compiler ( gcc ) and assembler

Ngày tải lên: 17/03/2014, 13:20

... 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of site directed mutants The mutated proteins D123W366A, D123Y394A and the ... Agrobacterium tumefaciens glycogen synthase CD D1 xD2x D3 W366A Y394A CD W366A Y394A CD + + + CD-D123 CD-St2.1 CD-St2.2 CD-St2.3 CD + D123 CD + D23 CD + D3 CD + D2 CD + D1 CD + St2.1 CD + St2.2 CD ... for cDNA synthesis [19] cDNA corresponding to CD was PCR amplified using Pfu polymerase (Promega, Madison, WI, USA) and the following primers: CDfw, AGAGC ATATGCACATTGTTCAT; CDrv, AAACTCGAGTCAC

Ngày tải lên: 22/03/2014, 21:20

... site The sequences of the 3¢ PCR primers were 5¢-GACTCTGAGCTCGTAATCTAGT CACGCTTA-3¢ for N-domain+, where underlined bases show the position of the SacI site, and 5¢- GGCCACT and C-domain+, where ... RNase T1 in the presence and absence of the enzyme, respectively Circular dichroism The CD spectra were recorded on a J-725 automatic spec-tropolarimeter from Japan Spectroscopic Co., Ltd (Tokyo, ... around the active site increases kcat by reducing the energy cost of conformational change during the cata-lytic reaction, it should increase Km concomitantly By restricting the increase of flexibility

Ngày tải lên: 23/03/2014, 13:20

... corresponding uPA enzymatic activity (C) Western blot detection of GAPDH in control and miR-23b-transfected cells (D) Western blot detection of c-met and GAPDH in cell extracts from control and ... miR-23b and of uPA and c-met AB2 control cells, which did not express uPA and c-met, displayed a high level of miR-23b, whereas the most aggressive HCC cells, which produced high levels of uPA and c-met, ... Keywords c-met; hepatocellular carcinoma cells; microRNA-23b; urokinase Correspondence G De Petro, Department of Biomedical Sciences and Biotechnology, Division of Biology and Genetics, University

Ngày tải lên: 29/03/2014, 23:20

... 5B,C), and genomic DNA PCR fragments indicated promoter construct integrity for all clones tested (data not shown) Such a dramatic effect proved that CCAAT-binding factors are crucial to control ... (Sp1+ and C⁄ EBPa+ or b+ plasmids) and some inhibitory (Sp1 and C⁄ EBPe) These effects were specific because they required the NR1L con-struct, and additional cotransfections using C⁄ EBPa and Sp3 ... combinations of Sp1 and CDP⁄ Cuts or C⁄ EBPs was studied by cotransfections with NRAMP1 promoter constructs containing or not containing the upstream myeloid-specific region (Fig 3C) Significant increases

Ngày tải lên: 30/03/2014, 02:20

... 5¢-primers, CMV IE ()740) 5¢-AGGT ACCCAATATTGGCCATTAGCC-3¢; CMV IE ()507) 5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢; CMV IE TGGCACCAAAATCA-3¢ and 3¢ primer, CMV IE (+65) 5¢-AAGATCTGACTGCGTTAGCAATTTAAC-3¢ The CMV ... 5¢-GTAACGCCAAT AtcGAtTTTCCATTG-3¢; mNF-jB2, 5¢-ACATGACCT TAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACT CAatcGatTTTCCAAGTC-3¢; mNF-jB4, 5¢-CCAAAAT CAAatcGatTTTCCAAAATG-3¢; mAP-1, 5¢-TAGCGG TTTatCgatCGGGGATTTCC-3¢ ... 1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2, TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCC ATGAGCTTCCTGAGCTT) The non-CpG-ODN 2041 (CTGGTCTTTCTGGTTTTTTTCTGG) served as a neg-ative control The LPS content

Ngày tải lên: 30/03/2014, 13:20

... sequence N-terminal extension G 5¢-GGCACTTAACCCATGGTACATGGACCTTGATATTGAC-3¢ 5¢-GTCAATATCAAGGTCCATGTACCATGGGTTAAGTGCC-3¢ 5¢-GGACCTTGATATTGACGGTCCAGATACC-3¢ 5¢-GGTATCTGGACCGTCAATATCAAGGTCC-3¢ 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ ... 5¢-GGATTGAAGGGGGAAGATCAGGAGGTGC-3¢ 5¢-GCACCTCCTGATCTTCCCCCTTCAATCC-3¢ R C-terminal extension TS XL1-blue supercompetent cells (Stratagene) p26 cDNA inserts were recovered by digestion with BamHI and XhoI, electrophoresis ... thermotolerance induction in Escherichia coli, protection of insulin and citrate synthase from dithiothreitol- and heat-induced aggregation, respectively, and preservation of citrate synthase activity

Ngày tải lên: 30/03/2014, 20:20

... human c-Fos, 5¢-CCGGGGATAGCCTCTCT TAC-3¢ (upstream) and 5¢-CTTCTCCTTCAGCAGGT TGG-3¢ (downstream); human c-Jun, 5¢-TTCTATGAC GATGCCCTCAA-3¢ (upstream) and 5¢-GTTGCTGAG GTTTGCGTAGA-3¢ (downstream); ... specific antibody for FLAG-tagged TRAF6, with a c-Src specific antibody for c-Src and with Myc specific antibody for Myc-tagged Akt. Trang 9These data suggested that TRAF6 and c-Src are signi-ficant ... extracts were probed with a FLAG specific antibody for FLAG-tagged TRAF6, with c-Src specific antibody for c-Src, with Myc specific antibody for Myc-tagged Akt WT and Akt DN, and with HA specific antibody

Ngày tải lên: 31/03/2014, 07:20

... ability to induce G2 cell cycle arrest is an additional biological property of Vpr [17–19] This cytostatic effect of Vpr occurs by inhibiting the activation of p34cdc-cyclin B, and thus contributes ... or Tat and nucleic acids A C K N O W L E D G E M E N T S We thank C Lenoir and P Petitjean for peptide synthesis, C Vitta for his technical assistance in circular dichroism experiments, C Dupuis ... HIV-1 particles seems to occur by a process in which NCp7 cooperates with p6 [9] In infected cells, Vpr is localized to the nucleus and has the ability to interact with several host cellular proteins

Ngày tải lên: 31/03/2014, 23:20

... victory circles (Combination 3) 12 unique GOLD-GOLD-SILVER-SILVER victory circles (Combination 4) 4 unique GOLD-GOLD-GOLD victory circles Thus, there are unique victory circles The correct ... orderings consist of the exact same victory circle Thus, the 24 victory circles must be cut in half; there are actually only 12 unique victory circles that will contain 2 GOLD medalists and 1 SILVER ... 4Gold-Gold victory circles: Albert is awarded a GOLD Bob is awarded a GOLD Cami is awarded a GOLD Notice that this victory circle is exactly the same as the following victory circles: Albert-GOLD, Cami-GOLD,

Ngày tải lên: 14/05/2014, 16:55

... of Chromosome Aberrations and Gene Fusions in Cancer [http://cgap.nci.nih.gov/Chromosomes]. 21 Bacher U, Schnittger S, Haferlach C, Haferlach T: Molecular diagnostics in acute leukemias Clin Chem ... Methods Cell Line Panel Cell lines were purchased from the American Type Cul-ture Collection [ATCC] and the German Resource Cen-tre for Biological Material [DSMZ] and grown to standard culture ... concurrent BCL2 and MYC translocations: the critical factors associated with survival Blood 2009, 114:2273-2279. 45 Jares P, Colomer D, Campo E: Genetic and molecular pathogenesis of mantle cell

Ngày tải lên: 18/06/2014, 22:20

... Sequences of characters • String Objects are created by Java compiler when it encounters a sequence of characters in double quotes • New strings can be created, but once created, they cannot ... 44import java.awt.Color;public abstract class Shape2 { protected float x, y; // coords of object protected Color c; class Circle extends Shape2 { protected float radius; public void Draw() { } ... separate class variable per instance Trang 35public class Static {public static void main(String args[]) } class X { static int foo = 10; } Trang 36public class TestStatic {public static void main(String

Ngày tải lên: 11/07/2014, 21:20

... os.schedule(); // Scheduling Point exitCS(); ////// Critical Section End } /* Task() */ Notice how the functional part of this routine is surrounded by the two function calls enterCS and exitCS ... and exitCS The block of code between these calls is said to be a critical section A critical section is a part of a program that must be executed atomically That is, the instructions that make ... only link the file sched.obj to include an instance of the scheduler This instance is called os and is declared as follows: extern Sched os; References to this global variable can be made from within

Ngày tải lên: 05/08/2014, 10:21

... creating and removing breakpoints are provided by most debugging tools < BACK CONTINUE > C CISC Complex Instruction Set Computer Describes the architecture of a processor family CISC processors ... one for which it produces object code A cross-compiler runs on a host computer and produces object code for the target. D DMA Direct Memory Access A technique for transferring data directly between ... devices memory space A processor's standard address space Contrast with I/O space. microcontroller A microcontroller is very similar to a microprocessor The main difference is that a microcontroller

Ngày tải lên: 05/08/2014, 10:21

... commands using COM 3009.5.4 Calling user-defined functions using COM 3029.5.5 Calling XLM functions using COM 3039.5.6 Calling worksheet functions using COM 3039.6 Maintaining large data structures ... recalculation event: xlcOnRecalc 281 Trang 15xii Contents8.14.6 Trapping a window selection event:xlcOnWindow 2818.14.7 Trapping a system clock event:xlcOnTime 2828.15 Miscellaneous commands and ... help; MikeClinch for his consistently good advice without which life would be very much moredifficult; Les Clewlow and Chris Strickland for their perspective as authors and for theirencouragement

Ngày tải lên: 09/08/2014, 16:20

... 135 wrapper class, 342 WriteLine() command, as function call, 74, 160 writing code, CD115–CD119 collection class, CD61–CD71 constant, CD6 forms code, CD175–CD179 generic code, 348–349 generic collections, ... 196 responding to, CD21–CD22 throwing, CD17–CD19 Exception class creating own, CD13–CD15 overriding, CD22–CD26 exception mechanism example of, CD10–CD13 overview of, CD9–CD10 exclamation point (!) operator, ... 110 StreamReader, CD50–CD54 StreamWriter, CD45–CD50 String, 187 structure compared to, 327 wrapper, 342 class constructor, 235–236 class function, 128 class inheritance, 219 class library, CD27, CD29, CD39–CD43 393 Index 28_597043...

Ngày tải lên: 04/10/2013, 21:20

... application behaves and its flexibility to meet creative demands. If your main concern is present and future portability, your best choice is vanilla CGI. You can be confident that your CGI scripts ... The Apache::PerlRun Class A.3 The Apache::RegistryLoader Class A.4 The Apache::Resource Class A.5 The Apache::PerlSections Class A.6 The Apache::ReadConfig Class A.7 The Apache::StatINC ... apachectl control utility; the configuration and log directories (conf and logs ); a directory for executable CGI scripts, cgi-bin; a directory for dynamically loaded modules, libexec; header...

Ngày tải lên: 21/12/2013, 11:15

... Using the compiler’s features. Explicit storage allocation and deallocation In C and C ++ , you have to explicitly allocate and deallocate dynamic storage through malloc and free (for C) and through ... allocation debugging tools As discussed earlier in the section called C and C ++ speci c problems, one of the causes of problems with C and C ++ code, is the policy of requiring explicit allocation ... detecting a number of basic semantic problems such as type mismatches and dead code. For gcc (the GNU C compiler) there are a number of options that affect what static analysis gcc does and what...

Ngày tải lên: 21/01/2014, 06:20

... nonspeci c interactions between monoclo- nal antibodies and scrapie-associated fibrils. J Biol Chem 279, 301 43 301 49. 44 Korth C, Stierli B, Streit P, Moser M, Schaller O, Fis- cher R, Schulz-Schaeffer ... (PrP C ). PrP Sc proteins are characterized according to size and glycoform pattern. We analyzed the glycoform patterns of PrP C obtained from humans, sheep, cattle and mice to find interspecies ... (PrP C ) to a pathological isoform (PrP Sc ) accompanied by a conformational change from a largely a-helical form into a b-sheet structure [4]. In contrast to PrP C , the infectious PrP Sc protein...

Ngày tải lên: 19/02/2014, 02:20