likes and dislikes of a man in a relationship

... analysis of the Trang 8system at the beginning of each iteration is performed The analysis provides information to hierarchically classify the components as main, secondary, and remainder, and ... plant are equality constraints of the optimization problem In addition, the fixed process steam and process hot water demands are also equality constraints [19] The inequality constraints are ... system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of most significant decision

Ngày tải lên: 05/09/2013, 16:30

... Trang 1Experiences in Design and Implementation of a High Performance Transport Protocol Yunhong Gu, Xinwei Hong, and Robert L Grossman National Center for Data Mining Trang 3TCP and AIMD• ... the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity – Otherwise, any flow will obtain at least half of its fair share • ... has been very successful in the Internet – AIMD (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable

Ngày tải lên: 15/01/2014, 15:59

... car); and f) A manufacturer’s letter confirming the date of manufacture of the car All documents submitted MUST be in the English language Notarised translations are acceptable For further information ... registered as a new car in a foreign country which adopts the same or higher exhaust emission standards as Singapore (at the time of its registration as a new car in Singapore) Trang 6Fuel Economy Labelling ... High Intensity Discharge (HID) Headlamps Annex Certificate of Compliance with Exhaust Emission Standards – Submission Format B Trang 2IMPORTATION AND REGISTRATION OF NEW AND USED CARS IN SINGAPORE

Ngày tải lên: 07/03/2014, 11:20

... drive transcription in a mammalian cell reporter gene assay in in vivo results Experimental procedures Parasites The NMRI strain of S mansoni was maintained in snails (Biomphalaria glabrata) and ... as that found only in RARs (NR1B) [17] (Fig 4C) The splice site of A DNA binding domain B Ligand binding domain Fig 1 Sequence alignment (A) Alignment of DNA binding domain (C domain) and its ... (containing 20 amino acids at the 5¢ end of the DBD, the DBD and 40 amino acids at 3¢ end of the DBD) and SmRXR1 (Glu251 to Asn376) (containing 20 amino acids at 5¢ end of the DBD, the DBD and

Ngày tải lên: 07/03/2014, 11:20

... CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT GGCCCGGTCCCTGACTTGG-3¢) and (5¢-TCACAGCA GGTTGATCTCGTCC-3¢) ... sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT CCC-3¢), and checked for the presence and sequence ... hot aci-dic phenol procedure RT-PCR was performed on DNAse-treated RNA extracts Primers used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG

Ngày tải lên: 07/03/2014, 16:20

... The nuclear receptors used in monopartite gene switch format generally consist of a transcriptional activation domain fused to a DNA-binding domain (DBD) and a ligand-DNA-binding domain (LBD) ... flexible and that a single amino acid Trang 3substitu-tion can result in significant changes in ligand binding,transactivation activity, and specificity [35,36] Kumar et al [35] demonstrated that substitution ... Trang 1switch and demonstration of its utility in regulationof transgene expression in plants Venkata S Tavva1,2, Subba R Palli1, Randy D Dinkins3and Glenn B Collins2 1 Department of Entomology,

Ngày tải lên: 16/03/2014, 06:20

... land, land preparation, plant stock, planting, watering.  Maintenance:- weed control, fertilizing, pruning and thinning, fire and pest protection.  wood; commercial thinning, final harvest ... Trang 1Chapter 10: Case Study in Financial Modeling and Simulation of a Forestry Investment Investment in forestry as an example of capital budgeting techniques applied to long ... non-wood; flora gathering, recreation, land renewal. Trang 5Forest Yield Factors Wood growth is measured by the MAI: Mean Annual Increment; ‘the annual increase in cubic meters of harvestable timber

Ngày tải lên: 23/03/2014, 04:20

... Xishuangbanna Trang 4Xishuangbanna is a mountainous area with small flat valleys and basins, which make up only 5% of its total land area Such basins are called “Meng” in Dai or “Bazi” in local ... province of Vietnam, there are about 26,000 Hani (including Akha) in Lai Chau and Lao Cai provinces, Northwestern Vietnam I was informed by some Akha villagers and officials in Phongsaly of Laos ... growth in last decade, it is quite reasonable to estimate the total population of Akha in China is about 260,000 According to Mr Zalanq Mazev, director of Association of Traditional Akha in Myanmar

Ngày tải lên: 23/03/2014, 21:22

... gene and 3¢ end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... D.S (1999) Interactions controlling the membrane binding of basic protein domains: phenylalanine and the attachment of the myristoylated alanine-rich C-kinase substrate protein to interfaces Biochemistry

Ngày tải lên: 30/03/2014, 13:20

... of the FLAG epitope without significantly perturbing the folding of the underlying (ba)8-barrel This was inves-tigated by comparing the far-UV and near-UV CD spectra of PRAI and FLAG-PRAI in a ... plasmon resonance (SPR) On acquiring SPR data for FLAG-PRAI and trPRAI binding to mAb M2, it became apparent that the latter displayed increased binding at any given concentration (Fig 6) Affinities ... of the PRAI subdomain (A) Thermal denaturation of PRAI and trPRAI-His as monitored by CD at 219 nm Raw data and smoothed curves are shown (B) Fluores-cence emission spectra of PRAI and trPRAI-His

Ngày tải lên: 30/03/2014, 20:20

... percentages of identical and similar amino acids are indicated. Fig 4 Preparation of an anti-ISP36 serum (A) Expression of human His 6 -ISP36 in E coli and its purification using Ni-agarose beads A1 and ... analysis are shown. Trang 5proteins Filamentous proteins listed in Table 1, i.e.lamin B1, lamin A, lamin C, vimentin, keratin types 1 and 2 and actin, were all included in this group Lamins are ... were lamin A, lamin C, lamin B1, vimentin, keratin type 2, keratin type 1 and actin, respectively, which are all filament proteins Uricase (band 15 in Fig 1B) probably represented a contaminating

Ngày tải lên: 30/03/2014, 20:20

... application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood Abstract Background: In preparation ... containing sodium heparin (Catalogue #362753) For all data shown samples were maintained at ambient temperature and were processed within an hour of collection, but addi-tional studies indicated acceptable ... a NanoDrop 1000 (NanoDrop, Wilmington, DE) RNA quality was evaluated using a 2100 Bioanalyzer (Agilent, Palo Alto, CA, Agilent 2100 expert software ver-sion B.02.05.SI360), and all samples had

Ngày tải lên: 18/06/2014, 16:20

... skewed, with a majority serving in two major metropolitan areas (Accra and Kumasi), and inadequate numbers in remote and rural districts Recent policies increasing health worker salaries have reduced ... considering a rural post, and settled in Accra This was affirmed by interviews in UW and BA, where many complaints focused on the absence or inadequacy of units Hospital Infrastructure In addition ... few things, but of late the internet [has been] fluctuating, so learning has been off and on.” (UW) In larger towns of BA and in the capital of UW doc-tors mentioned that internet was starting

Ngày tải lên: 18/06/2014, 17:20

... the authors have read and approved the final manu-script MH: took part in all parts of the design and development of the AF6 and in the writing of the manuscript BN: participated in the data analysis, ... made statistical analyses and gave scientific input in the analysis of the results and in the writing of the manu-script AB: gave scientific input in the design of the study and in the writing ... analysis, in the preparation of tables and writing of the manuscript KK: gave scientific input regarding the statistical method-ology, the analysis of the results and in the writing of the manuscript

Ngày tải lên: 18/06/2014, 18:20

... GH Variables associated with a decreased quality of life Variables associated with increased quality of life + = Indicates a statistically significant relationship Trang 10Table 7: Items and ... valerie.moal@ap-bertrand.dussol@ap-hm.fr; Yvon Berland - yvon.berland@ap-bertrand.dussol@ap-hm.fr; Roland Sambuc - roland.sambuc@ap-hm.fr * Corresponding author Abstract Background: In the absence of a French ... both in population health assessment and in clinical trials [1,2] QOL indicators are based on the completion of standardized and well-vali-Published: 13 October 2008 Health and Quality of Life Outcomes

Ngày tải lên: 18/06/2014, 19:20

... Trang 4Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Uganda Variable Total Undetectable viral load ... Onwu-jekwe DI, Audu RA, Araoyinbo ID, Onyewuche JI, Salu OB, Adedoyin JA, Musa AZ: Management of HIV-1 infection with a combina-tion of nevirapine, stavudine, and lamivudine: a preliminary report ... MD, USA, 4 National Institute of Allergy and Infectious Diseases, National Institutes of Health, USA and 5 Institute of Tropical Medicine and University of Antwerp, Antwerp, Belgium Email: David

Ngày tải lên: 20/06/2014, 08:20

... the statistical parameters and impact on the final instruments’ content, taking into account the phrasing of the items and their meaning 1 Exploratory factor analysis (EFA): The sample was randomly ... 13.4% are of Malay descent, and 9.2% are of Indian descent [6] Singapore has a high literacy rate (80.4%) and the main language of communication and commerce is English In 2007, Singapore launched ... Trang 1R E S E A R C H Open AccessThe positive mental health instrument: development and validation of a culturally relevant scale in a multi-ethnic asian population Janhavi Ajit Vaingankar1*†,

Ngày tải lên: 20/06/2014, 15:20

... concentration levels of the pharma-ceuticals diclofenac and carbamazepine In contrast, the toxicity of fractions 1, 3, and 4 was probably caused by organic contaminants in additional precipitation ... solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C The working standard solutions were prepared by further diluting the stock standard ... toxicity of total was-tewater (liquid and particulate phases) might be higher than that reported in this paper Pharmaceuticals and PAHs The selection of the analyzed organic wastewater pollu-tants was

Ngày tải lên: 20/06/2014, 20:20

... degradation are important in both Cartilage degradation occurs as a result of an imbalance of extracel-lular matrix proteinases and their inhibitors, in particular the matrix metalloproteinases ... that C2-ceramide and TNF-α treatment of articular cartilage result in the increased synthesis and activation of MMPs, increased release of proteoglycan, and increased cell death These effects are ... lead to an inhibition of protein synthesis and increased apoptosis, which may also affect cartilage integrity Increased expression and activation of MMPs, in the absence of a corresponding increase

Ngày tải lên: 09/08/2014, 01:23

... cells; V κ = variable kappa chain gene; Vλ = variable lambda chain gene. Research article Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with ... preferential usage of particular variable lambda chain genes (Vλ2E) and variable kappa chain genes (VκA27) Moreover, clonally related VLchain rearrangements were identified; namely, VκA27–Jκ5 and VκA19–Jκ2 ... anti-52 kDa Ro(SS-A) and anti-52 kDa La(SS-B) antibodies, had marked hyper-gammaglobulinemia, and was rheumatoid factor (RF) pos-itive The patient did not have extraglandular organ manifestations

Ngày tải lên: 09/08/2014, 03:24