Ngày tải lên: 22/06/2014, 18:20
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
... better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers. The possible expla- nations may be: (1) some rare cancer death rates are ... is also associated with both smok- ing and cancer deaths, was not measured in this study, and the separate calculation of risk patterns in urban and rural areas was used as a surrogate analy- sis ... which had low rates, the discrepancies in CIs were increased because of a large standard error, and this was particularly true for rural residents. The relative risks for cancer deaths between...
Ngày tải lên: 26/10/2012, 09:48
Experimental investigation of exergy destruction in a 8-kW power plant
Ngày tải lên: 05/09/2013, 16:11
Binding a Group of Radio Buttons in a Windows Form
... all records from table TBL0709 in the sample database and to update changes made back to the database. The DataAdapter is used to fill a DataTable in a new DataSet with the schema and data ... simple-bind to data, there is no way to bind a group of RadioButton controls to a data source. Binding a single radio button to a data source isn't a particularly common requirement—nor is ... binding manager base for the table. [ Team LiB ] Recipe 7.9 Binding a Group of Radio Buttons in a Windows Form Problem You need to bind a field in a database to a radio button and update...
Ngày tải lên: 07/11/2013, 13:15
Tài liệu Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold III; Planar domains " doc
... decompose a surface with quadatric curvature decay into disjoint almost stable subdomains and a “remainder” with quadratic area growth. For applications of the results of this part in [CM5], ... their boundary. in R 3 (and not that the interior boundary has small length) . This distinction is important; in particular if one had a bound for the area of a tubular neigh- borhood of the interior ... curves and surfaces with extrinsic balls. We will always assume that these intersections are transverse since this can be achieved by an arbitrarily small perturbation of the radius. 542 TOBIAS...
Ngày tải lên: 14/02/2014, 17:20
Tài liệu THE BACTERIOLOGY OF PULMONARY TUBERCULOSIS IN A POPULATION WITH HIGH HUMAN IMMUNODEFICIENCY VIRUS SEROPREVALENCE ppt
...
Ngày tải lên: 15/02/2014, 13:20
Tài liệu Báo cáo khoa học: "Beefmoves: Dissemination, Diversity, and Dynamics of English Borrowings in a German" ppt
... something of a global lingua franca, many languages are cur- rently undergoing a process of introducing new loan- words borrowed from English. However, while the motivations for borrowing are well ... train a maximum entropy classi- fier, using character 1- through 6-grams (including word boundaries) as features. Since we could not manually annotate a large portion of the MZEE cor- pus, the training ... the dynamics of this process are poorly understood. While mainstream political debates often frame borrowing as evidence of cultural or linguistic decline, it is particularly per- vasive in youth...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: "THE REPRESENTATION OF INCONSISTENT INFORMATION IN A DYNAMIC MODEL-THEORETIC SEMANTICS" ppt
... Model-theoretic semantics provides a computationally attractive means of representing the semantics of natural language. However, the models used in this formalism are static and are usually infinite. ... "An interpretation system for Montague grammar", American Journal for Computational Linguistics, microfiche 74, 23-96. Friedman, J., D. Moran, and D. Warren (1979) "Dynamic interpretations", ... Dynamic models are incomplete models that include only the information needed for an application and to which information can be added. Dynamic models are basically approximations of larger...
Ngày tải lên: 21/02/2014, 20:20
THE CONSTITUTION OF LAW Legality in a Time of Emergency potx
... for apartheid: after all, in holding racist views, he was in the mainstream of politics. Rather, he strongly favoured a unitary system of government over a federal one for South Africa because ... Africa, he was a member of the Imperial War Cabinet during the First World War, played a significant role in the foundation of the League of Nations, and was made Chancellor of the University of ... situations requires a departure from the rule -of- law regime appropriate for ordinary times and so whatever role one accords to judges in ordinary times has to be significantly rethought. And often...
Ngày tải lên: 07/03/2014, 02:20
Báo cáo Y học: Expression of the V-ATPase proteolipid subunit of Acetabularia acetabulum in a VMA3-deficient strain of Saccharomyces cerevisiae and study of its complementation pdf
... vacuolar-membrane- enriched fractions of the transformants of AACEVAPD1 –6. The vacuolar-membrane-enriched fractions were prepared as described in Materials and methods. Samples of the membrane ... prb1 D 1. 6R, can1, GAL] [10]. The YN11 strain was derived from YPH499 strain, and YN45 strain was prepared by the use of YN11 and BJ5458 strains. Preparation of AACEVAPD1 –6 5 0 RACE and 3 0 RACE ... without any misreading was innoculated in 30 mL of Luria –Bertani/ampicillin medium and the plasmid DNA was purified over a Qiagen-Tip100 column. Conversion of TAA to CAA and preparation of recombinants...
Ngày tải lên: 08/03/2014, 23:20
Đề tài " The space of embedded minimal surfaces of fixed genus in a 3-manifold I; Estimates off the axis for disks " doc
... genus in a fixed (but arbitrary) closed Riemannian 3-manifold. The key for understanding such surfaces is to un- derstand the local structure in a ball and in particular the structure of an embedded ... graph near 0. Figure 6: Theorem 0.4— finding a small multi-valued graph in a disk near a point of large curvature. Theorem 0.3 is particularly useful when combined with a result from [CM4] asserting ... function or is a double spiral staircase where each staircase is a multi-valued graph. This will be done by showing that if the curvature is large at some point (and hence the surface is not a graph),...
Ngày tải lên: 14/03/2014, 22:20
Pulmonary Tuberculosis: Knowledge, Attitudes and Practices of Selected Physicians in a Tertiary-Care Hospital docx
... number and have reached as high as 32% from reports from tertiary referral hospitals. 3 ( ) Add two drugs to current regimen and reevaluate ( ) Refer to an Infectious disease Specialist for consult ... Luke’s realize the magnitude of TB problem in the country. However, the majority does not favorably rate the National TB Program and DOT. The lack of awareness that TB is reportable and the paperwork ... forms in the offices of our private practitioners, the lack of information on the health authority to contact and not just the paperwork that it entails may have contributed to a certain degree...
Ngày tải lên: 15/03/2014, 03:20
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG MG3K6S GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC MG3K6S7K GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC T3 AATTAACCCTCACTAAAGGG B1 GCCGGGATCCTAGGGCGAATTGGGTACC 864 ... Taq DNA polymerase were pur- chased from Takara Shuzo (Japan). The mCAP RNA capping kit and proteinase K were from Stratagene. RNase was purchased from Boehringer-Mannheim (Germany). Rabbit reticulocyte ... Yoshiyuki Kayano, Sayaka Nakao, Nagisa Sakurai, Hiroyuki Iwata 1 and Rumi Ishisaka Department of Biological Chemistry and 1 Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University, Yamaguchi,...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
... the results of our parameter scanning, where only 12.5% of systems with increased HXT(V max ) reach steady-state. Those systems with increased HXT limiting rate that are able to reach steady-state ... branching steps are significantly correlated with each other, this correlation is always positive, and where FCCs for the main-chain of glycolysis (HK-ADH) are correlated with each other, these, too are also ... role for hexokinase and the remainder of main- chain glycolysis having only minimal relevance. This pattern has previously been observed in a study of glycolytic flux control in rat heart perfused...
Ngày tải lên: 17/03/2014, 11:20
Báo cáo khoa học: "Interaction of Knowledge Sources in a Portable Natural Language Interface" docx
Ngày tải lên: 17/03/2014, 19:21
Báo cáo Y học: Balanced expression of single subunits in a multisubunit protein, achieved by cell fusion of individual transfectants docx
Ngày tải lên: 18/03/2014, 01:20