... photographs on the family altars they clearly watch over their descendants’ actions and are accepted as having responsibilities as well as expectations for the family In the third case study, the ... best care and treatment.’ The couple has, however, moved away from the house of the mother-in-law and a younger sister-in-law of the wife, not the mother-in-law, has agreed to care for the children ... within the family In the Confucian tradition that has influenced Vietnamese culture, sons make the ancestral sacrifices, pray to the ancestors and carry on the family line; failure to have children,
Ngày tải lên: 16/12/2017, 17:16
... Uniqlo, and the Gap Audis sell briskly in China and India,and KFC is a mainstay restaurant in places as far- ung as China and Nigeria Localbusinesses in the South, both small and large, have also ... create a natural a nity—and countries of Africa Itsfamiliarity with poor infrastructure and governance gives it an advantage in dealingwith these nations And of course, Latin America has a longstanding ... fteen African countries Theywere now part of the managerial mix of Bharti Airtel, along with leaders from Sri Lankaand Bangladesh, where the company had expanded the year before Many wore typicalWestern
Ngày tải lên: 29/03/2018, 13:39
A Transect Through the Foreland and Transitional Zone of Western
... o u g h o u t a r r a y s in the f o o t w a l l and h a n g w a l l that are t r u n c a t e d by the ramp A -5 92 Trang 14A -5f r a c t u r e s i n d i c a t e s that the f r a c t u r e s ... e l a t i v e l y p l a n a r and the fault zone is thick In c o m p a r is o n the u p p e r b e d d i n g p l a n e f a u l t s are f o l d e d in the ramp areas, cut by ramp faults, and the ... g h a n g l e n o r m a l f a u l t s have b e e n m a p p e d a l o n g the C h a m p l a i n t h r u s t fault and in cut the e a s t e r n part of the p l a t f o r m s e q u e n c e are M
Ngày tải lên: 25/10/2022, 03:14
“Just take a bite!”Just take a bite!” Is keeping a child at theIs keeping a child at the table during mealtimestable during mealtimes REALLY the best way to getREALLY the best way to get them to eat?them to eat?
... •Jean Chan (ADHC, Rosebery) •Katharine White (ADHC OT, Rosebery) •Maria Andreadis (ADHC, Fairfield) •Amanda Khamis (Cerebral Palsy Alliance, Kingswood) •Jill Rosen (former member from ADHC) Trang ... trained therapists Possible that that clients have already associated “negative” feelings around mealtimes/food intake. Parents sharing their own experiences and learning from other parents ... Comfort and safety are the most important aspects of the mealtime When children feel safe and comfortable, they are more willing to risk and participate in new experiences.” Trang 26collected data
Ngày tải lên: 15/12/2022, 15:22
Abolishing anonymity of sperm, egg, and embryo donor, and the right to know the biological parents of a child conceived through assisted reproductive technology
... genetic parent (the donor) to have more say in meeting the child can create challenges for both the legal parents and the child Early contact with the donor may shorten the time needed for legal parents ... circumstances that affect their ability to sustain a livelihood. 2 Children and mothers are entitled to special care and assistance All children, whether born in or out of wedlock, shall enjoy the same ... phrase "as far as possible" emphasizes the importance of facilitating a child's access to their rightful benefits Additionally, Article 8 of the Convention safeguards the child's right to know their
Ngày tải lên: 08/03/2025, 06:18
Báo cáo y học: "Looking through the ''''window of opportunity'''': is there a new paradigm of podiatry care on the horizon in early rheumatoid arthritis" pot
... but the area has been identified as a research priority. A new paradigm for podiatrists focuses on combination therapy targeted at inflammatory lesions and associated mechanically-based impairments. ... Case-series data reveal the early stages of irreversible foot-related walking disability and, by detailed gait analysis, functional impairment at the ankle, tarsus and MTP joints [24]. What are ... Østergaard M: Ultrasonography of the metatarsophalangeal joints in rheumatoid arthritis: comparison with magnetic resonance imaging, conventional radiography, and clinical examination. Arthritis
Ngày tải lên: 10/08/2014, 21:24
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataatttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and deduced protein of CcGCC1 gene Start and stop codons are underlined ... D I P Q 541 ctttacatgaaaatgagcatgcaaataagagaggcacttcaattgcagctagaactcgag L Y M K M S M Q I R E A L Q L Q L E L E 601 aagcatcttcatgatcaattagagatgcaaatgaatttacaaaagctgattgaggatcaa K H L H D Q L
Ngày tải lên: 11/08/2014, 11:21
Báo cáo y học: "A novel approach to modelling water transport and drug diffusion through the stratum corneum" pdf
... Burnaby, BC, V5A 1S6, Canada Abstract Background: The potential of using skin as an alternative path for systemicallyadministering active drugs has attracted considerable interest, since the creation ... Trang 1R E S E A R C H Open AccessA novel approach to modelling water transport and drug diffusion through the stratum corneum Tatiana T Marquez-Lago1,2*, Diana M Allen3*, Jenifer Thewalt4 ... although devoid of a metabolism, confer most of the skin resistance tochemical and physical attacks, and in their normally dehydrated state also provide obstacles against water loss through the
Ngày tải lên: 13/08/2014, 16:20
osenton - boomer destiny; leading the u.s. through the worst crisis since the great depression (2009)
... significant that it simply causes the dam to burst The last American crisis was filled with dramatic events, such as the rareattack of the U.S mainland, a Wall Street crash, and a long and painful warthat ... as a member of the Awakening Generationthrough the crisis of the American Revolution, as Abraham Lincoln did as a member of the Transcendental Generation through the crisis of the CivilWar,1and ... candidate Barack Obama when heidentified with President Ronald Reagan—an odd comparison, especiallyfor an African American candidate for the U.S presidency “Ronald Reaganchanged the trajectory of America
Ngày tải lên: 03/11/2014, 19:18
A STUDY ON HOW SCRIPTWRITERS FLOUT CERTAIN MAXIMS OF GRICE’S COOPERATIVE PRINCIPLE TO CREATE VERBAL IRONY THROUGH THE SITCOM FRIENDS FROM EPISODE 1 TO EPISODE 10
... placing the spectator a step ahead of at least one of the characters.‖ This means that dramatic irony is characterized by a incongruity between what the audience knows to be true and what the ... potential for humour These characters remain essentially the same, rather than developing as they would in comedy drama.‖ To make it clearer, Wikipedia suggests that sitcom is usually a narrative-based ... factors, among which, the great potential for verbal irony created by the language used itself plays an important part The verbal irony appeared in the series have not only attracted the young but also
Ngày tải lên: 02/03/2015, 14:22
Developing students' reading proficiency through extensive reading in an IELTS prepation course - A case of the 3rd year English majors at Hanoi University of I
... Kaplan (1966) has claimed that –Each language and each culture has a paragraph order unique to Trang 20itself, and … part of the learning of a particular language is the mastery of its logical ... to another in such a way that changes in that factor are causually related to another in such a way that changes in that factor are causually related to changes in the other So, it’s not just a ... use them at all Scanning for specific information Summarizing Identifying parts of speech Paraphrasing Sequencing 3 Matching paragraph headings with paragraphs in the reading passage The reading
Ngày tải lên: 28/03/2015, 10:27
Thai Literature at the Crossroads of Modernity Advancing a Critique of Neo-liberal Development through the Writings of Khamsing Srinawk and Chart Korbjitti
... machine” (within a “dog eat dog” capitalist framework) Most Thais accept the frequently repeated mantra that to be Thai is to trust in nation, religion, and monarchy (chaat, satsanah, mahakaset) ... consumerist materialism In modern Thailand, traditional values and the institutions that legitimate these values – the sangha and the monarchy – are losing their once revered status in the wake of ... that a fusion of military power and royal legitimacy was reestablished” by utilizing the symbols of Trang 33 nation, religion, and monarchy (chaat, satsanah, mahakaset) to further the military’s
Ngày tải lên: 14/05/2015, 12:09
The study of the mediation of ohanin, a king cobra (ophiophagus hannah) toxin through the central nervous system
... Siang, Yajnavalka Banerjee, Nandha Kishore, Pawlak Joanna, Syed Rehana, Dileep Gangadharan, Mr Koh Cho Yeow, Ms Liu Ying and Ms Tay Bee Ling, who make up the “Prof Kini’s Lab” staff, students and ... the Animalia kingdom, Chordata phylum, Vertebrata subphylum, the Reptilia class and Squamata order (Evans, 2003) Venomous Snakes There are many different and diverse species of animals across all ... Cobras, coral snakes, kraits, mambas, sea snakes, sea kraits and Australian elapids Viperidae (viperids) True vipers and pit vipers, including rattlesnakes Table 1 Snakes that known to cause dangerous
Ngày tải lên: 16/10/2015, 15:35
Leading strategic change breaking through the brain barrier
... Successful strategic change for the organization is all about changing individuals first, because they are the organization To change organizations, you must break through the brain barrier Perhaps Yogi ... Pearson Education North Asia Ltd Pearson Education Canada, Ltd Pearson Educación de Mexico, S.A de C.V Pearson Education—Japan Pearson Education Malaysia, Pte Ltd FINANCIAL TIMES PRENTICE HALL ... change And I love the maps—they provoke my intellect and imagination.” Margaret J Wheatley Author of Leadership and the New Science and Turning to One Another “A significant barrier to any major
Ngày tải lên: 30/11/2015, 01:05
a path with heart - a guide through the perils and promises of spiritual l- jack kornfield
... absolutely right It takes an egg as well as a sperm to start a Nobel laureate Every one of them has had a mother as well as a father You can say all you want of fathers, but their contribution ... and become wealthy Others the same and remain poor Marriage fills one with energy, Another it drains Don’t trust ways, they change A means flails about like a donkey’s tail Always add the gratitude ... they asked, “Then what are you?” He replied simply, “I am awake.” The word Buddha means to awaken How to awaken is all he taught Meditation can be thought of as the art of awakening Through the...
Ngày tải lên: 11/06/2014, 12:01
the psychopath test_ a journey through the madne - jon ronson
... midst of quite a bad anxiety attack I had been interviewing a man named Dave McKay He was the charismatic leader of a small Australian religious group called The Jesus Christians and had recently ... was a religious scholar from Iran.” “They were all academics,” said James They had all received the package the exact same way Deborah had—in a padded envelope from Gothenburg upon which was written ... force tasked with defeating the Goliath And they have won some epic victories There was, for example, their campaign back in the 1970s and 1980s against the Australian psychiatrist Harry Bailey...
Ngày tải lên: 06/07/2014, 01:59
A way through the maze the challenges of maintaining UK pension schemes
... many firms rather than a single, monolithic balanced manager Financial innovation is also playing a part in the changed landscape “Multi-asset funds now have more tools at their disposal,” says ... Raj Mody, a partner and actuary at the pensions practice of PricewaterhouseCoopers, believes that LDI can be a crude, unreliable and expensive approach He advocates a proprietary strategy that ... market capitalisation 29 Between 21% and 30% of market capitalisation 25 Between 31% and 40% of market capitalisation Between 41% and 50% of market capitalisation 50% of market capitalisation or...
Ngày tải lên: 06/12/2015, 23:05
Improving Maternal, Newborn, Child Health, and Family Planning Programs through the Application of Collaborative Improvement in Developing Countries: A Practical Orientation Guide pptx
... neonatal asphyxia and immediately apply resuscitation increased dramatically Infant and child care: In Senegal and Honduras, applying the collaborative improvement led to substantial increase ... family planning counseling and provide them with job aids Rural Senegal Benin, Mali, Uganda, Guatemala, Nicaragua, Honduras, El Salvador Afghanistan and Mali with high unmet demand for postpartum ... essential drugs for the treatment of childhood malaria, pneumonia and diarrhea Arrange a private room for family planning counseling at post partum care units Train maternal health staff on...
Ngày tải lên: 23/03/2014, 06:20
Tài liệu Playing through: A Guide to the Unwritten Rules of Golf potx
... should take the time to stop and appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another ... between the ninth and tenth holes Naturally, they heard all about what had taken place Later, at the nineteenth hole, we learned that they’d talked about my mishap for most of the back nine.Apparently, ... putting and hand them to us This made the round easy and very pleasant I have an electric handcart One day I hadn’t charged the battery fully and it ran out of juice As I was pushing it back to the...
Ngày tải lên: 22/02/2014, 08:20
HIDDEN TREASURE - A map to the child’s inner self
... creative, non-threatening ways to reach the child is the task of the therapist Contact The next issue that I address in the therapeutic process is that of contact Is the child able to make and ... I was invited to a classmate’s birthday party I had never been to such a party and had grand visualizations of what must take place In my family, my mother generally made a special dinner and ... important to the child s well-being The first task of the child is to separate and without this bonding there is really nothing to separate from and it can cause a great deal of anxiety on the part...
Ngày tải lên: 24/02/2014, 10:50