... water AMA was from Sigma Aldrich (Milan, Italy) All other reagents, purchased from different companies, were of ana-lytical grade Rabbit serum raised against HNE–protein adducts was from Alpha ... considered as an extracellular counterpart of the chemical inactivation of HNE that occurs intracellularly via GST and other enzymes that are abundantly expressed in nasal mucosa [22] Fur-thermore, ... the aqueous matrix of biological fluids Therefore, a protein scavenger that could trap, and eventually deli-ver, 4-hydroxyalkenals to appropriate degradative pathways, might aid other inactivating...
Ngày tải lên: 23/03/2014, 10:20
... Jane Byrne 5 It was in 1875 - joined the staff of the astronomical observatory at Harvard University a Anna Winlock, who b that Anna Winlock c as Anna Winlock d Anna Winlock then 6 - that the ... that of the other words 4)A uncertain B technical C attention D attraction 5)A psychology B cosmonaut C accident D national 6) A uncertainty B satisfaction C psychology D approximate 7) A advanced ... word that has the underlined part pronounced differently from that of the others 26 Choose the word that has the underlined part pronounced differently from that of the others 27 Arrange the words...
Ngày tải lên: 24/04/2021, 20:45
An analysis of the suggested translation of chapter 2 from the book without saying a word by kasia wezowski and patryk wezowski 2018
... language (SL) by equivalent textual material in another language (TL).” - J.C.Catford “Translation is a process of rendering the meaning of a text into another language in the way that the author ... structure The translator attempts to reproduce the contextual meaning accurately within the constraints and limitations of the grammatical structure of the translated language Cultural words are transferred ... language The translation contains the full meaning of the original, including the meaning that creates the aesthetic value of the original and compromise on the meaning is appropriate so that there...
Ngày tải lên: 21/08/2023, 21:53
The Marketing Strategy of a multinational join stock company.doc
... conditioners of famous companies such as Toshiba(Japanese), Mitsubishi(Japanese),Trane(American) and Sanyo(Japanese) Medical and technical equipment and machinery, mainly imported from the USA, Italy,Germany ... importing,material providing and preceding the contracts Organizing the sales of products isanother main task of the department Financial and Accounting department: this department deals with all ... messageswithout any product changing Although it retains the scale economics on themanufacturing side the firm sacrifices potential saving on the communication way .another strategy is dual adaptation...
Ngày tải lên: 27/10/2012, 16:51
Tài liệu Definitions of Ratings and Other Forms of Opinion pdf
... located, the availability and nature of relevant public information, access to the management of the issuer and its advisers, the availability of pre-existing third-party verifications such as audit ... property/casualty, health, mortgage, financial guaranty, residual value and title insurance sectors, as well as to managed care companies such as health maintenance organizations The IFS Rating does ... expiry of any applicable grace period, cure period or default forbearance period following a payment default on a bank loan, capital markets security or other material financial obligation; c the...
Ngày tải lên: 16/02/2014, 03:20
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
... GAACCAT), ECF-A141Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q146A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s instructions (mutagenic ... salt, 50 lMiron(III) sulfate and 50 lMmanganese sulfate When the D600of the culture reached a value of 0.4, IPTG was added to a final concentration of 10 mM and the culture incubated for a further ... Yamakura and T Matsumoto for the analyses of iron and manganese in protein samples We also wish to thank H Steinman for the gift of E coli OX326A We finally thank Mr M Farrugia for photographic assistance....
Ngày tải lên: 21/02/2014, 01:21
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... is the DXDXE motif that spans strand 4 of the TIM barrel and includes the glutamate that acts as the catalytic acid The active site grooves of these chitinases are lined with aromatic amino acids ... mutational effects, the pH-dependency of these effects, pKa calculations and available structural informa-tion The results indicate that the pKaof the catalytic acid (Glu144) is cycled during catalysis ... why the D142N mutant retains considerable activity, whereas the D142A mutant does not It has been shown by X-ray crystallo-graphy that replacement of the Asp142 analogue by alanine in other family...
Ngày tải lên: 07/03/2014, 14:20
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
... Trang 1Annals of Mathematics On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri Trang 2On the Julia set of a typicalquadratic polynomial with ... spherical area in the growth condition(2.7) David proved that the analogue of the measurable Riemann mapping orem [AB] holds for the class of David-Beltrami differentials [Da]: David-Beltrami differential ... root of U. and a rectifiable arc in J (F ) The latter arc starts at an iterated preimage of β, follows along the boundaries of drops passing from child to parent until it reaches the boundary of a...
Ngày tải lên: 14/03/2014, 22:20
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
... Trang 1Annals of Mathematics The diameter of the isomorphism class of a Banach space By W B Johnson and E Odell Trang 2The diameter of the isomorphism classof a Banach space By W B Johnson and ... < ∞ then X as well as every isomorph of X is D(X)-elastic Thus the Main Theorem is an immediate consequence of Trang 4Theorem 1 If X is a separable Banach space and there is a K so that every ... mean that Y is a closed (infinite dimensional) subspace of X The closed linear span of the set A is denoted [A] We use standard Banach space theory terminology, as can be found in [LT] The material...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
... envelope, such as the phosphate groups within the LPS molecules of the OM in Gram-negative bacteria or the lipoteichoic acids on the surface of Gram-posi-tive bacteria In the case of Gram-negaGram-posi-tive ... of action; peptide–membrane interaction; proteomics Correspondence M L Mangoni, Unita` di Diagnostica Molecolare Avanzata, II Facolta` di Medicina e Chirurgia, Azienda Ospedaliera S Andrea, via ... reached its maximum ( 65% calcein leakage) at a peptide⁄ lipid molar ratio of 1.5 These results are comparable with those found for other membrane-active antimicrobial peptides, such as cathe-licidin...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... with a Bio-Rad pro-tein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease con-tamination of the purified protein preparations was ruled out by the ... kDa, which partly shifted from the major bands, coinciding with the appearance of a significant deacyla-tion activity Any bacterial contaminadeacyla-tion of our protein preparations that might be ... precursor at prolonged storage was ruled out by the absence of bacterial DNA Characterization of Table 1 Peptide mass fingerprint of the 22 and 42 kDa fragments The 22 and 42 kDa bands on Coomassie...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt
... of the eyestalk (open bar) and thoracic ganglia (diago-nally shaded bars) of females The percentage indicates the GSI of the females M (B) indicates the expression pattern of MIH-B in the same ... Homarus americanus [9] than to the mandibular organ-inhibiting hormones of the crab Cancer pagarus [10] MeMIH-A and MeMIH-B are non-sex-specific and are expressed in the eyestalks of males and females ... on the initial mechanism of hormone action In other words, the in vitro results indicate that MeMIH-B may act directly on the hepatopan-creas and ovary to inhepatopan-crease the rate of vitellogenin...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Characterization of the dimerization process of a domain-swapped dimeric variant of human pancreatic ribonuclease pdf
... monomers Although an increasing number of structures of domain-swapped dimers are already avail-able [2], experimental data on the thermodynamics and the mechanism of domain swapping have, until recently, ... thermogram was corrected from instrumental and chemical baselines Cp ex , expression of the partial heat capacity of the protein relative to the heat capacity of the protein in the native state. ... for the putative mechanism of domain-swapping dimerization of RNase A and the human pancreatic ribonuclease variant, PM8 For RNase A (A), the protein is subjected to conditions that favour the...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Critical roles of Leu99 and Leu115 at the heme distal side in auto-oxidation and the redox potential of a hemeregulated phosphodiesterase from Escherichia coli pptx
... auto-oxidation and the redox potential of the heme iron We found that mutation of these hydrophobic amino acids substantially influences the rate of auto-oxidation and the redox potential of the ... Trang 1in auto-oxidation and the redox potential of a heme-regulated phosphodiesterase from Escherichia coli Nao Yokota, Yasuyuki Araki, Hirofumi Kurokawa, Osamu Ito, Jotaro Igarashi and Toru ... This study a Fast O2dissociation (or fast auto-oxidation) may have hampered the determination of exact values because the O2binding rate was similar to that of the wild-type (Table 3). Trang 6with...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: Key substrate recognition residues in the active site of a plant cytochrome P450, CYP73A1 ppt
... can accommodate a diverse array ofcompounds, as far as they are structural analogues ofthe natural substrate Structural requirements for such analogues include a planar, aromatic structure, a ... Cytochrome c reductase activity ofthe NADPH-cyto-chrome P450 reductase was assayed as in [17] Trans-CA hydroxylation was assayed using radiolabelled trans-[3-14C]CA and TLC analysis ofthe metabolites [18] ... create a steric hindrance to the binding ofthe substrate above the haem iron As expected, the I371A mutation substantially decreases CA affinity and the ability to desolvate the active site Around...
Ngày tải lên: 17/03/2014, 10:20
The Gospels in the Second Century An Examination of the Critical Part of a Work Entitled ''''Supernatural Religion'''' pptx
... laon mou laon mou kai taen ouk aegapaemenaen haegapaemenaen.] Hosea ii 23. [Greek: Kai agapaeso taen ouk aegapaemenaen, kai ero to ou lao mou Daos mou ei se.] [Greek: Gamma symbol] _Paraphrase with ... considerable clearness, and there is always an advantage in drawing data from a wide enough area Thequotations are ranged under heads according to the degree of approximation to the text of the LXX ... Judaea, Nebuchadnezzar Trajan;Assyria stands for Syria, Nineveh for Antioch, Arphaxad for a Parthian king Arsaces, Ecbatana for Nisibis orperhaps Batnae; Bagoas is the eunuch- service in general;...
Ngày tải lên: 17/03/2014, 15:20
THE CHEMICAL HISTORY OF A CANDLE A COURSE OF LECTURES DELIVERED BEFORE A JUVENILE AUDIENCE AT THE ROYAL INSTITUTION ppt
... to the pound. They have been replaced since then by the steel-mill, and then by the Davy-lamp, and other safety-lamps of various kinds. I have here a candle that was taken out of the _Royal ... into that out-of-the-way place a sort of wax which a kind friend has sent me, and which forms a new material for the manufacture of candles. And how are these candles made? I have told you about ... shape. [...]... by their mutual attraction for each other, and as they reach the flame they are gradually burned Here is another application of the same principle You see this bit of...
Ngày tải lên: 22/03/2014, 14:20
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... globalization1 as a significant and growing trend impacting internal audit today and in the future As organizations expand to take advantage of global markets and supply chains, internal audit faces ... U.S.-centric approach to business and accounting And in the United States, the internationalization of accounting standards may lead to a change in the language of accounting The growth of outsourcing and ... by CAE awareness of the need to be sensitive to how people think and act in China, India, and other key trading-partner areas • • Trang 20The CAE of a global defense and aerospace company that...
Ngày tải lên: 23/03/2014, 04:20
USING SUPPLEMENTARY READING MATERIALS TO DEVELOP VOCABULARY FOR FIRST YEAR STUDENTS AT THE COLLEGE OF TECHNOLOGY AND FOREIGN RELATION ECONOMY HANOI
... “do a decision” So, “heavy rain” and “make a decision” are often referred to as collocations and we say that “heavy” collocates with “rain”, or that “heavy” and “rain” are collocates of each other ... one Aspects of meaning can also be useful in vocabulary teaching and learning They show how the meaning of one item relates to the meaning of others These are various relationships and here are ... just cannot happen in any meaningful way” (McCarthy, 1990: viii) Vocabulary is an essential component of language “Vocabulary is central to language” and “words are of critical importance to the...
Ngày tải lên: 14/09/2015, 09:29
Motivating grade 11 students to learn english through examination taking strategy training at yen thanh 2
... theoretical basis for language learning strategies, examination-taking strategies, and the motivational roles of strategy training in general and examination-taking strategy training in particular Practically ... is also a form of matching, but across items rather than within them, and, as in the previous case, the respondent may make the match without understanding the material very well or at all Another ... with a mechanism to evaluate their own progress and to evaluate the success of the training and the value of the strategies in multiple tasks As a type of language learning strategies, test-taking...
Ngày tải lên: 07/09/2013, 13:43