isa a multi methodological approach for planning choices

... used to extract surface temperature data ENVISAT ASAR (Advance Synthetic Aperture Radar) was used to estimate soil moisture using a data fusion approach The relationship between vegetation density, ... based, approach is digital image classification based on a single image The techniques and algorithms used can vary, but all are based on the spectral similarity of pixel value and a set of sample ... day Rainfall in this area is limited and irregular Annual precipitation is 1024 mm, while evaporation in some years is equivalent to precipitation At some locations annual rain fall can be as

Ngày tải lên: 05/10/2022, 10:29

... applied an overlap refinement strategy that retained 20% overlapping content using a character-based suffix method This approach achieves a balance between maintaining semantic integrity and capturing ... superficial similarity to identify relevant information For example, an economist may seek a case study that illustrates the same economic principle as another, or a programmer may aim to resolve an ... medical examples and 20,000 general examples are collected from real-world cases, with an additional 20,000 hard negatives generated using the strategy described in appendixA For the mathematical

Ngày tải lên: 10/09/2025, 16:11

... the adoption of the practical approaches and the application of a broader range of methodologies especially mathematical analytical (MA) models Therefore, various MCDM methods have been formulated ... embrace a strategic approach to facilitate the management of suppliers’ partnership and prevent “one-size-fits-all” approach for supplier partnership management (Gurler AGI, 2007; Yilmaz O et al., ... external and internal influencing indicators (Kumar et al., 2014), this range takes the qualitative and quantitative selection and evaluation criteria into account (Sarkis & Talluri 2002), and

Ngày tải lên: 26/05/2020, 22:39

... uncertain data and imprecise knowledge The main advantages of fuzzy AHP are that the consistency ratio can be measured, and, it can apply to both tangible and intangible criteria (Durán & Aguilo, ... to increase The various DEAs have been applied continuously in many application areas because of the advantages of this method However, one of the disadvantages of DEA is that it cannot rank efficient ... disposal municipality Formulate and solve the cost-based transshipment model for IWM to provide candidate alternatives Take the candidate alternatives as DMUs and input-output variables into DEA

Ngày tải lên: 26/05/2020, 22:42

... http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassTrang 3Full file at http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassGlobal Rationale: Multiply ... http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassTrang 8Full file at http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassTrang 9Full ... http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassTrang 22Full file at http://testbanksstore.eu/Test-Bank-for-Dosage-Calculations-A-Multi-Method-Approach-by-GiangrassTrang 23Full

Ngày tải lên: 05/01/2021, 13:04

... regression Vapnik, the goal is to find a function 𝑓(𝑥) that has at most deviation from the actually obtained targets 𝑦𝑖 for all the training data, and at the same time, is as flat as possible ... them know, at least, some information about their (predicted) performance on the courses, and may determine which ones are appropriate for their background and ability Another advantage is to ... (ANNs) are a computational approach which is based on a large collection of neural units loosely modeling how the brain solves problems ANNs are structured in layers Layers are made up of a

Ngày tải lên: 01/02/2021, 04:21

... regression Vapnik, the goal is to find a function 𝑓(𝑥) that has at most deviation from the actually obtained targets 𝑦𝑖 for all the training data, and at the same time, is as flat as possible ... them know, at least, some information about their (predicted) performance on the courses, and may determine which ones are appropriate for their background and ability Another advantage is to ... (ANNs) are a computational approach which is based on a large collection of neural units loosely modeling how the brain solves problems ANNs are structured in layers Layers are made up of a

Ngày tải lên: 17/03/2021, 17:30

... this anal-ysis can be found in Table 1 The majority of patients were male with an average age of approximately 39 years of age The average age of onset of the disease was approximately 23.1 years ... Trang 1Open AccessResearch article Relationships among neurocognition, symptoms and functioning in patients with schizophrenia: a path-analytic approach for associations at baseline and following ... indicates a poor fit Analyses were conducted using SAS® Version 8 for PC Path-analytic models were evaluated using SAS PROC CALIS Results Patient Characteristics The baseline values for all measures

Ngày tải lên: 11/08/2014, 17:20

... clique in a multi-partite graph, and intro-duce a two-pronged approach, based on graph pruning and mathematical programming, to solve it In particular, we first formulate the problem as an integer ... Trang 1Open AccessResearch A combinatorial optimization approach for diverse motif finding applications Elena Zaslavsky* and Mona Singh* Address: Department of Computer Science & Lewis-Sigler ... optimal solutions to the underlying optimization problem Conclusion: Our results demonstrate that a combined graph theoretic and mathematical programming approach can be the basis for effective and

Ngày tải lên: 12/08/2014, 17:20

... Trang 1Open AccessResearch A linear programming approach for estimating the structure of a sparse linear genetic network from transcript profiling data Sahely Bhadra1, Chiranjib Bhattacharyya*1,2, ... Bhattacharyya*1,2, Nagasuma R Chandra*2 and I Saira Mian3 Address: 1 Department of Computer Science and Automation, Indian Institute of Science, Bangalore, Karnataka, India, 2 Bioinformatics Centre, Indian ... Bangalore, Karnataka, India and 3 Life Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720, USA Email: Sahely Bhadra - sahely@csa.iisc.ernet.in; Chiranjib Bhattacharyya*

Ngày tải lên: 12/08/2014, 17:20

... (1386-5': GAAACTAT-GCCAAAAACAAGT and 2129-5': TAATCTAGCCTTCT-GTCCTGG) and two internal gag-specific primers (1731N 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously ... days Evaluation of the transduction rate DNA was extracted from macaque PBMCs and the amount used for each sample was normalized based on data for amplification of the β-globin gene, using ACCATGGTGCTGTCTCCTGC-3' ... six male cynomolgus macaques (Macaca fascicularis) were chronically infected by 4 AID 50 of a primary and pathogenic isolate of SIVmac251 for more than one year They have been characterized for

Ngày tải lên: 13/08/2014, 13:20

... factorial microarray experiments Kerr et al [12] and Pavlidis [13] applied the analysis of variance model (ANOVA) to factorial microarray data using the parametric linear regression approach ... the interaction effects as predefined by the linear parametric model in ANOVA We also analyzed the same data set using the existing parametric approach, i.e ANOVA model, with aim at comparing ... [14] and SVD-based multivariate statistical methods, for example, principal components analysis [4,15] and correspondence analysis (CA) [16,17] have been applied in analyzing multidimensional microarray

Ngày tải lên: 14/08/2014, 14:21

... toxin and Vibrio cholerae The latter is a fascinating case of how multiple phages contribute to bacterial pathogenicity It is postulated that some adaptations of nonpathogenic bacterial strains ... ecological niche might also be mediated by prophage genomes [4] As mobile DNA elements, phage DNA is a vector for lateral gene transfer between bacteria [5] As reviewed by Canchaya et al [6] technically ... prophage sequences in bacterial genomes as mostly they are cryptic or in the state of mutational decay Prophages account for a substantial amount of interstrain genetic variability in several bacterial

Ngày tải lên: 14/08/2014, 14:22

... formats and normalization parameters. Experimen- tal design contains parameters such as the number of test arrays and negative control arrays for one particular assay. Data file format describes ... tion, and ProCAT will automatically discard flagged spots. A key aspect of ProCAT is the two-parameter approach for reducing spatial nonuniformity. Several factors can affect the performance of ... particularly applicable to functional protein microarrays in comparison to antibody arrays, and, therefore, the normalization techniques used for DNA microarrays are usually not directly applicable

Ngày tải lên: 14/08/2014, 17:22

... Trang 1SOCIAL INTERACTION ANALYSIS USING A MULTI-SENSOR APPROACHGAN TIAN NATIONAL UNIVERSITY OF SINGAPORE 2015 Trang 2SOCIAL INTERACTION ANALYSIS USING A MULTI-SENSOR APPROACHGAN TIAN B.Sc., East ... Also, it is increasingly accepted that social interactions are critical for maintainingphysical, mental and social well-being [Venna et al., 2014] However, as theavailability of large-scale and ... enable a variety of techniques tocollect, manage and analyze this vast array of information, to addressimportant social issues and to see beyond the more traditional disciplinaryanalyses [Wang

Ngày tải lên: 08/09/2015, 15:34

... Trang 1A MULTISCALE MODELING APPROACH FOR THE PROGRESSIVE FAILURE ANALYSIS OF TEXTILE COMPOSITES MAO JIAZHEN NATIONAL UNIVERSITY OF SINGAPORE 2014 Trang 2A MULTISCALE MODELING APPROACH FOR ... is normally integrated as a tubular form over a cylindrical mandrel Fiber yarns are inter-wound together in the braided performs The tubular form is available in biaxial and triaxial architectures ... model 93 Table 3.6 Degradation factors for all damage modes in mesomechanical analysis 101 Table 3.7 Experimental and simulation results for plain woven composites 108 Table 3.8 Degradation factors

Ngày tải lên: 10/09/2015, 09:11

... scan is estimated to select subsequent gazes for the subsequent gazes for the laser scanner A disadvantage is that the first scan is made manually and each additional scan is made after calculations ... 3.20 Approach point for cavity The edge points of the cavity are always approached from the approach point which is at a distance k away from the center of the circle After digitization of each ... generated from the scanned data Reverse engineering can also be used as means to archive their outdated design data to obtain a database of their products This is done to repair and maintain facilities...

Ngày tải lên: 16/09/2015, 14:04

... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... experimental data obtained at 22 °C (0 days at °C) and °C (1 day, days and days at °C), respectively The results of parameter estimation represent means ± SD (n = 50) Experimental data represent means ... [21], and it was shown that acclimation does not take place in total darkness Strand et al [22] found that cold acclimation was significantly enhanced in plants with increased SPS activity, leading...

Ngày tải lên: 14/02/2014, 22:20

... empirical analysis using a large German panel data set Fred Ramb 26 22 2007 Volatile multinationals? Evidence from the labor demand of German firms Claudia M Buch Alexander Lipponer 23 2007 International ... 34 2007 Factor-MIDAS for now- and forecasting with ragged-edge data: a model comparison for German GDP Massimiliano Marcellino Christian Schumacher 35 2007 Monetary policy and core inflation Michele ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko...

Ngày tải lên: 22/03/2014, 23:20