is method to return a boolean value

... instance? In this paper, we address this question by systematically training the graph-based REG algorithm on a number of “semantically transparent” data sets of various sizes and evaluating on a held-out ... Corpora for Natural Language Generation: Language Generation and Machine Translation (UCNLG+MT), pages 90–92 Ruud Koolen and Emiel Krahmer 2010 The D-TUNA corpus: A Dutch dataset for the evaluation ... Di Fabbrizio, Amanda Stent, and Srinivas Bangalore 2008 Trainable speaker-based referring expression generation In Twelfth Conference on Computational Natural Language Learning (CoNLL2008), pages...

Ngày tải lên: 07/03/2014, 22:20

... AY582061 PB2 B/Norway/1/84 AF101984 HA B/Memphis/5/93 AF129902 NA B/Memphis/3/93 AF129915 Putative Parents 3SEQ p -value Breakpoint Δ c-AIC B/Shiga/T30/98 B/Alaska/03/1992 B/Guangdong/05/94 B/Chile/3162/2002 ... shifts for each of the recombinants have strong bootstrap support (data not shown) However, large influenza viral genes in the databases may actually represent assembled artifactual contigs from ... viruses was very rare or absent and could not confer a substantial fitness advantage Therefore, we conclude that homologous recombination is unlikely to play a major role in influenza B virus...

Ngày tải lên: 20/06/2014, 01:20

... SIAM Journal on Mathematical Analysis 15 (1984), no 2, 316–332 [12] M H Pei, Nonlinear two-point boundary value problems for nth-order nonlinear differential equations, Acta Mathematica Sinica ... order equations, Acta Mathematicae Applicatae Sinica 14 (1991), no 3, 397–403 (Chinese) Guangwa Wang: Department of Mathematics, Xuzhou Normal University, Xuzhou 221116, China E-mail address: wgw7653@xznu.edu.cn ... Case is not true Case Suppose that there exists some i ∈ {1,2, ,n − 2} such that y (i−1) (a) − Pi y (a) , y (a) , , y (n−1) (a) > β(i−1) (a) (3.10) Then by the analogous analysis, we have Pi y (a) ,...

Ngày tải lên: 22/06/2014, 21:20

... Acknowledgements I would like to express my heartfelt gratitude to Assistant Professor Andy Yip for accepting me as his graduate student I would also like to take this opportunity to thank ... we adapt the augmented Lagrangian method developed in [25] to optimize the Euler’s elastica to solve the Euler-Lagrange equations In the second method, we formulate a new Euler-Lagrange equation ... THE AUGMENTED LAGRANGIAN METHOD ON LEVEL SETS 3.1 Solution for the augmented Lagrangian method on level sets In the case of the augmented Lagrangian method on level sets, the augmented Lagrangian...

Ngày tải lên: 16/09/2015, 12:35

... Education, Inc Publishing as Pearson Addison-Wesley Slide 4- 22 Function Call Details  The values of the arguments are plugged into the formal parameters (Call-by -value mechanism with call-by -value ... Programmers choose meaningful names for formal parameters  Formal parameter names may or may not match variable names used in the main part of the program  It does not matter if formal parameter ... 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 4- Function Call Syntax   Function_name (Argument_List)  Argument_List is a comma separated list: (Argument_1, Argument_2,...

Ngày tải lên: 12/09/2012, 22:48

... Affectionate Calm Carefree Irresistible Satiating Secure Angry Annoyed Bad Cruel Disagreeable Discouraged Disgusted Irritated Lonely Mean Miserable Nauseated Rejected Sad Suffering Sunk Tormented Afraid ... chocolate, vanilla ice cream, fried chicken and mashed potatoes and gravy Pizza and chocolate produced the strongest emotions based on Analysis of Variance The terms active, adventurous, affectionate, ... (2008) has also argued that concepts such as satisfaction are more appropriate than simple acceptance for commercial products, and that both brand and packaging need to be considered along with...

Ngày tải lên: 03/04/2013, 21:07

... Bank Is the “Central” Bank? An Application of Markov Theory to the Canadian Large Value Transfer System Morten L Bech, James T E Chapman, and Rod Garratt Federal Reserve Bank of New York Staff ... topology, interbank, money markets Bech: Federal Reserve Bank of New York (e-mail: morten.bech@ny.frb.org) Chapman: Bank of Canada (e-mail: jchapman@bankofcanada.ca) Garratt: University of California, ... course, departing from the standard designation of a country or countries’ principal monetary authority as the central bank The Bank of Canada is the central bank of Canada by that account The...

Ngày tải lên: 16/02/2014, 12:20

... Investment and Tourism: Empirical Evidence from India Saroja Selvanathan, E .A Selvanathan and Brinda Viswanathan * Working Paper 47/2009 Ecology, Environment and Sustainable Development in Indian Fiscal ... municipal taxes to ensure that the wastewater is treated with secondary treatment and the quality of the water discharged to the river is high They are willing to pay about half as much to increase ... indicates an extremely good fit, and all the coefficients are statistically significant Treated wastewater quantity and quality are significant factors in the choice of a wastewater treatment...

Ngày tải lên: 18/02/2014, 01:20

... whose aim is to add value to a traditional product of regional origin and act as a platform for the fair and balanced coordination of interests and efforts in the same value chain The reach of ... the mark Trademark Office Trademark Office Registration Appropriate national Ministry Legal basis Protection based on an act Protection based on administrative registration of public law (law, ... et al 2006) BOX   Switzerland: Rye bread from Valais The idea of adding value to typical rye bread came about through a broad rural development strategy which the Swiss Canton of Valais started...

Ngày tải lên: 18/02/2014, 21:20

... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...

Ngày tải lên: 19/02/2014, 16:20

... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... (1735T-DEL) tissue-nonspecific alkaline phosphatase gene from hypophosphatasia patients J Bone Miner Res 13, 1827–1834 Cai G, Michigami T, Yamamoto T, Yasui N, Satomura K, Yamagata M, Shima M, Nakajima S, ... alkaline phosphatase gene in Japanese patients with hypophosphatasia J Bone Miner Metab 20, 28–33 Sawai H, Kanazawa N, Tsukahara Y, Koike K, Udagawa H, Koyama K & Mornet E (2003) Severe perinatal...

Ngày tải lên: 19/02/2014, 17:20

Ngày tải lên: 05/03/2014, 16:20

... here and is present in the S agalactiae PPase, kinase and adenylosuccinate synthase, but not in S agalactiae CovR ⁄ CsrR The motif is located at the surface of the SaPPase (Rantanen, unpublished), ... water molecule with a pKa of 7.5 [11] to achieve catalysis, a common feature in hydrolytic metalloenzymes [12] One residue that appears to take part in catalysis in HsSTP is His62, which may act ... length (A) rmsd bond angle (O) ˚ Mean B -value (A2 ) ˚ Mean B -value (A2 ), metal ions ˚ Mean B -value (A2 ), water molecules Ramachandran plot Residues in most favored region (%) Residues in additionally...

Ngày tải lên: 07/03/2014, 09:20

... The latter has the additional attributes of being available anywhere, at anytime and on any device If it was only a simple as a mouse-trap The complication is that for most customers they already ... Most customers have this tumour, and they should actively avoid growing it In another ebook, I explain a new business paradigm, Augmented Managed Services (AMS) This is yet another approach businesses ... use when assessing cloud value AMS is the paradigm where a predefined level of demand is managed internally and the remainder augmented with cloud services The apothegm is ‘Own the base and rent...

Ngày tải lên: 09/03/2014, 02:20

... to half a bag of rice” = “chúng n a bao gạo” Thông thường bạn nói số lượng vật/ đồ vật bị giảm, bạn liệt kê như: Now it’s down to just me, Claire, and Maria - Hiện tôi, Claire Maria Lưu ý sử ... thao “They’re down to teams now” = “giờ có đội” Hoặc nói việc bạn không sở hữu đồ vật mình: We sold the van, so we’re down to two vehicles now - bán xe tải, xe Hoặc đồ ăn: “We’re down to half a ... Với viết Daily English Speaking Lesson này, cho hiểu ro cách sử dụng " is down to " giao tiếp thường ngày Hãy xem thực hành cho ! “We’re down to only people now.” Công ty bạn v a gặp phải chút...

Ngày tải lên: 10/03/2014, 11:20

... light and heavy precursor masses for cross-linked candidate peptides analysis NanoLC-LTQ-Orbitrap data were processed automatically as described as well as manually 10 Acknowledgements 11 We are ... internal calibration was performed during mass spectra analysis using nonmodified peptides of both Ure2p and ⁄ or Ssa1p Acquisition and data analysis were performed using the explorer 3.5.2 and data ... assembly An alternative explanation that can account for this observation is that Ssa1p binds with higher affinity a conformational state of Ure2p as a result of the presence of the N-terminal domain...

Ngày tải lên: 15/03/2014, 00:20