... production and technologies To help accomplish the above objectives, the Handbook specifically provides technical informationon: ● The palm oil industry and the production process(es) for crude ... energy efficiencyand low-waste and non-waste technology Coagulation : The clumping together of very fine particles into larger particles caused by the use of chemicals (coagulants) Thechemicals neutralise ... Conversely, if the air velocity is too low, blocking of the separation duct and cyclone can occur Such occurrencewill affect the throughput of the palm oil mill Nuts coming from the nut fibre separator
Ngày tải lên: 25/01/2022, 08:41
... sequence detection system The cycling conditions were 10 min at 95∘C, followed by 40 cycles of 95∘C for 15 s, and 60∘C for 60 s To calculate the cycle number at which the transcript was detected ... chemotherapeutic efficacy against cancers [18] In addition, berberine has been reported to reduce the metastasis of human gastric cancer, prostate cancer, and breast cancer [19–21] However, the ... reduces the metastasis of chondrosarcoma cells by inhibiting the expression of𝛼v𝛽3 integrin 3.4 Berberine Reduces the Activity of the PKC𝛿 and c-Src Signaling Pathways PKC𝛿-dependent c-Src activation
Ngày tải lên: 01/11/2022, 08:57
Luận văn a study on historical and social background and the newness of language use in ‘pride and prejudice’ by jane austen
... information which contained the rationale, aims and objectives, methodology and scope of the study, Part Two went into further details of the historical and social background; and the newness of language ... each other despite the social differences 1.3.3 Collective activities Three main acts of the novel included a number of activities that brought the characters to take part in and to accomplish ... though the language usc was scon from various viewpoints, there was no doubt that they had some similarities in the use and choice of words and sentence structures, which were so typical for cach character
Ngày tải lên: 19/05/2025, 21:03
Luận văn a study on historical and social background and the newness of language use in ‘pride and prejudice’ by jane austen
... information which contained the rationale, aims and objectives, methodology and scope of the study, Part Two went into further details of the historical and social background; and the newness of language ... into the manner, human dignity and great strain” on the characters and the society they were living in, which made her novels connected to the contemporary world more than the traditional socicly ... attention to the main characters’ leading conversations in the three volumes which helped expose the cherish love and the theory of ‘pnde’ and ‘prejudice’ the main themes of the novel Amongst the three
Ngày tải lên: 16/08/2025, 21:24
Cocoa and Objective-C Cookbook [Hawkins 2011-05-23]
... 2Cocoa and Objective-C CookbookMove beyond basic Cocoa development using over 70 simple and effective recipes for Mac OS X development Jeff Hawkins BIRMINGHAM - MUMBAI Trang 3Cocoa and Objective-C ... motion. Chapter 5, Objective-C 2.0 introduces the new LLVM compiler and enabling garbage collection Chapter 6, Application Architecture covers the most common patterns used in application design and ... https://github.com/TouchCode/TouchJSON Who this book is for This book is perfect for the Mac OS X Cocoa developer who is ready to move beyond the basics and dive into more advanced Cocoa topics Conventions
Ngày tải lên: 17/04/2017, 10:06
C# 1: Introduction to programming and the C# language - eBooks and textbooks from bookboon.com
... and area of a circle As an example I will show an application, where the user must enter the radius of a circle, and the program calculates and writes the circle’s circumference and area Below ... document (in practice several or many) and the program is thus a simply document with commands Commands are also called statements Because these commands or statements are just text, the machine ... bookboon.com Click on the ad to read more “The perfect start of a successful, international career.” Trang 20C# 1 Introduction to programming and the C# language 20 Basic program architecture For
Ngày tải lên: 15/01/2021, 14:05
DSP applications using C and the TMS320C6X DSK (P6)
... Totest the results: 1 Select View Æ Watch Window and insert the two expressions j and out (right click on the Watch window) Click on +out to expand and view out[0] and out[1] that represent the ... of the periodicity and symmetry of thetwiddle constants to reduce the computational requirements of the FFT From the periodicity of W, and from the symmetry of W, (6.5) Figure 6.1 illustrates the ... RADIX-2The FFT reduces considerably the computational requirements of the discrete Fourier transform (DFT) The DFT of a discrete-time signal x(nT ) is - N) complex additions and N2 complex multiplications.Hence,
Ngày tải lên: 07/11/2013, 10:15
DSP applications using C and the TMS320C6X DSK (P7)
... there is uncertainty about the characteristics of a signal orwhen these characteristics change Copyright © 2002 John Wiley & Sons, Inc ISBNs: 0-471-20754-3 (Hardback); 0-471-22112-0 (Electronic) ... weights or coefficients for a specific time n The convolu-tion equaconvolu-tion (7.1) was implemented in Chapter 4 in conjuncconvolu-tion with FIR filter-ing It is common practice to use the terminology ... adaptive filter structuresand is an adjustable FIR filter Whereas the coefficients of the frequency-selectiveFIR filter discussed in Chapter 4 are fixed, the coefficients, or weights, of the adap-tive
Ngày tải lên: 07/11/2013, 10:15
Tài liệu DSP applications using C and the TMS320C6X DSK (P8) ppt
... Intrinsic Functions Using C Code (dotpintrinsic) Figure 8.2 shows the C code dotpintrinsic.c to illustrate the separate sum of products using two C intrinsic functions, _mpy and _mpyh, which have the ... multiply, and branch instructions must usethe D, M, and S units, respectively; the add and subtract instructions can use anyunit (except M) The instructions within the loop consume 16 cycles per ... shows the C code twosum.c, which obtains the sum of products of two arrays accessing 32-bit word data Each array consists of 200 numbers Separatesums of products of even and odd terms are calculated
Ngày tải lên: 14/12/2013, 14:15
Tài liệu DSP applications using C and the TMS320C6X DSK (P9) doc
... of both the loop filter and the DCO, and time stamps CCS buffers these data so that the data can be accessed by other applications on the PC host CCS has an interface that allows PC applications ... specified duration, a signal-detected mode is activated 9.10 MISCELLANEOUS PROJECTS The following projects were implemented using C/C3x and C2x/C5x code 9.10.1 Acoustic Direction Tracker The acoustic ... between the microphones and the source The angle c = arcsin(a/b), where the distance a is the product of the speed of sound and the time delay (phase/frequency) Figure 9.7 shows a block diagram of the
Ngày tải lên: 14/12/2013, 14:15
Tài liệu Value Maximisation, Stakeholder Theory, and the Corporate Objective ... ppt
... the multiple objectives thataccompanytraditional stakeholder theory I also discuss the Balanced Scorecard, the managerial equivalent of stakeholdertheory The same conclusions hold Balanced Scorecard ... role of the corporate objective function in corporateproductivityand efficiency, social welfare, and the accountabilityof managers anddirectors I argue that since it is logicallyimpossible to maximise ... way to keep score, stakeholder theorymakes managers unaccountable for their actions It seems clear that such a theorycan be attractive to the self interest of managersand directors Creating value
Ngày tải lên: 24/01/2014, 04:20
Tài liệu DSP applications using C and the TMS320C6X DSK (P1) ppt
... paral-CCS with the CD-ROM included with the DSK, preferably using the c:\ti structure (as default) The CCS icon should be on the desktop as “CCS 2 [’C 6000]” and is used to launchCCS The code ... radio, and so on These processors have becomethe product of choice for a number of consumer applications, since they havebecome very cost-effective They can handle different tasks, since they can ... with the function prototypes. 5 C6xdskinit.c: contains several functions used for the examplecodec_pollincluded with CCS It includes functions to initialize the DSK,the codec, the serial ports, and
Ngày tải lên: 26/01/2014, 07:20
Tài liệu DSP applications using C and the TMS320C6X DSK (P2) pptx
... processor The maximum level of theinput signal to be converted is determined by the specific ADC circuitry on thecodec, which is 3 V p-p with the onboard codec After the captured signal isprocessed, the ... The sampling rate F sis set by the frequency of the codec master clock MCLK of communica-2.3 PCM3003 STEREO CODEC FOR INPUT AND OUTPUT An audio daughter card based on the PCM3003 stereo codec ... out or reconstructs the output signal ADC, DAC, and allrequired filtering functions are performed by the single-chip codec AD535 onboardthe DSK.The AD535 is a dual-channel voice/data codec based
Ngày tải lên: 26/01/2014, 07:20
Tài liệu The Reproductive Plan Language RPL2: Motivation, Architecture and Applications pdf
... problem-specific and representation-specific operators, hybridisation with other search techniques, thehandling of constraints, the interpretation of the schema theorem, the meaning of genes and Trang ... considering the Schema Theorem(Holland, 1975) and the rˆole of “implicit parallelism” Holland introduced the notion of a theor-schema (pl theor-schemata) as a collection of genomes that share certain ... the schema theoremapplies equally to each of them The only link between the representation and the theorem isthe term ^(t) The theorem states that the expected number of instances of any schema
Ngày tải lên: 13/02/2014, 10:20
Tài liệu Báo cáo khoa học: The ubiquitin ligase Itch mediates the antiapoptotic activity of epidermal growth factor by promoting the ubiquitylation and degradation of the truncated C-terminal portion of Bid ppt
... caspases, which are required for many of the morphological changes that occur during apoptosis The mitochondrial release of cytochrome c and second mitochondria-derived activator of caspase (Smac⁄ DIABLO) ... which liberates cytochrome c and activates caspase 3 and the apopto-some [23] Transfection of tBid directly triggers mitochondrial-dependent apoptosis and caspase 3 acti-vation [17] Because Itch ... the ubiquitin ligase Itch, which can specifically interact with and ubiquitinate tBid, but not intact Bid Consistently, overexpression of Itch increases cell survival and inhibits caspase 3 activity,
Ngày tải lên: 16/02/2014, 09:20
C++ CLI The Visual C++ Language NET
... You could compile the class unchanged in C+ +/CLI with the following command line: cl /clr atom.cpp and it would be a valid C+ +/CLI program That’s because C+ +/CLI is a superset of C+ +, so any C+ + ... works and what doesn’t in the C# language, and planning the design of C+ +/CLI accordingly For example, C+ +/CLI provides better and more predictable object cleanup more easily in the language The ... (or the CLI class libraries), the common type system, and other helpful features such as garbage collection Garbage Collection and Handles One convenience of a managed language is garbage collection—that...
Ngày tải lên: 20/08/2012, 12:00
contexts meaning truth and the use of language aug 2005
... long as they are echoed by responses which, though superWcially critical of the sceptical view, in fact concede the premisses upon which it rests The problem is not novel: the misunderstandings ... instances involving the use of language, and to defend it against an increasingly fashionable sceptical attitude The projects of clariWcation and defence are complementary The critics of the traditional ... interpretations of the variable in question (the car John owns, the car he drives, the car on which he bet, the car in which he is sitting ), the contextual dependence aVecting possessive constructions...
Ngày tải lên: 11/06/2014, 00:58
words and thoughts subsentences ellipsis and the philosophy of language oct 2006
... from the Social Sciences and Humanities Research Council of Canada, the Canada Research Chairs programme, and the Ministry of Science, Energy and Technology of the Province of Ontario Contents ... isolation, and thereby perform full-fledged speech acts, then such -and- such implications obtain Conclusion: Such -and- such implications obtain The first premise rejects, in effect, the claim made in the ... difference, I need to introduce a crucial distinction between two senses of ‘force’ Call ‘forceAct ’ that which attaches to certain kinds of actions For instance, there is the forceAct speci c to...
Ngày tải lên: 11/06/2014, 02:18
ELUCIDATING THE ROLE OF REDOX EFFECTS AND THE KU80 C-TERMINAL REGION IN THE REGULATION OF THE HUMAN DNA REPAIR PROTEIN KU
... the primary transfectant and introduced to cells for hour 11 Table DNA Oligonucleotides Primer name Sequence (5'→3') Sense ATACCGTCCCACCATCGGGC Antisense GAATTCCTAAGCAGTCACTTGATCCTTTT 30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC ... GAATTCCTAAGCAGTCACTTGATCCTTTT 30A CCCCTATCCTTTCCGCGTCCTTACTTCCCC 3 0C GGGGAAGTAAGGACGCGGAAAGGATAGGGG 12 Following incubation, virus inoculum was removed and cells were covered with a 1% agarose and complete media solution, ... in band intensity to the phenomenon of molecular crowding increasing the local concentration of Ku80CTR for Ku70/80 C These experiments were also conducted in the presence and absence of DNA and...
Ngày tải lên: 24/08/2014, 11:02
Semiotics and the philosophy of language
... content 'other' for which the represented object stands The Cross, the Crescent, the Hammer and Sickle stand for Christianity, Islam, and Communism, respectively T h e s e signs are iconic because ... concrete occurrence or the abstract type? Is is the phonetic utterance [kat], or the phonological and lexical model /cat/? Is it the fact that hic et nunc I have ten cats at home (with all the ... cogency of the inference If (there is) the first, then (there is) the second But what is the epistemological value of if and then? 1.10 Strong codes and weak codes The Stoics' inference was the...
Ngày tải lên: 27/08/2016, 16:36