in the pink— a sign of corrosion

... Kathem Rowayed, and his son Mezher Abdullah Kathem Rowayed, both senior officials at Al-Baath party in Dujail at the time of the accident.• Ali Dayeh Ali, a senior official in Al-Baath party in ... Kazem Jaafar, Mohammad Abde, Jawad Alzobaydi, Abas Jasem, Mohammad Ramadan, Sattar Tawfeeq, Yahya Alkhafaji, Sadeq Majeed Hameed, Hashem Adnan Jasem, and Mahroz Hadi How many members are currently ... Mr Ahmad as a "complainant" instead of a "witness," causing concern for the defense lawyer regarding the implications of Ahmad's statement The lawyer questions the judge about Ahmad's legal status,

Ngày tải lên: 18/10/2022, 11:39

... "Explaining resistance to system usage in the ChatBot: A view of the dual-factor model" with the goal of surveying and analyzing factors affecting user satisfaction regarding the intention ... give a comprehensive picture of the shared characteristics of all the variables These characteristics include eachvariable's mean, mode, median, and standard deviation Additionally, this analysis ... promote the adoption and usage of chatbotsystems.Trang 21CHAPTER 2: HYPOTHESIS2.1 Information Quality and Satisfaction The metric of Information Quality was initially introduced in DeLone andMcLean's

Ngày tải lên: 08/03/2025, 06:14

... by the market as investments in human capital Ballester et al (1999) also find that this investment amortizes at a rate of 34% a year Using cross-sectional data, Darcy (2000) found a similar amortization ... demonstrate that R&D expense has a long-term effect on the value of a company which can be thought of as a form of intangible capital R&D expense may also include a wage component Adding a variable ... regressions in the rational expectations tests The results of the annual regressions in each of the tables in this paper are evaluated using cross-temporal t-statistics based on the mean value of the

Ngày tải lên: 07/03/2014, 02:20

... (arrows) The absorbance at 280 nm did not show a clear peak at the same position as zinc, indicating that the proteins binding zinc in these fractions scarcely contained any aromatic amino acid ... was less than half of that in ovary at stage 1, and remained at a similar value to stage 4 Testes at stage 2 were not analyzed because of a lack of samples We calculated the amount of zinc bound ... zinc-binding site(s) Sea urchins may use either of these pathways, according to the demand for zinc; the latter pathway appears to be more important in females than in males, for the transport of

Ngày tải lên: 16/03/2014, 05:20

... increases in per capita medical care spending among infants and among the elderly for acute care in the United States They suggested the spread of technology in the treatment of cardiovascular ... countries, the trend appears to be towards increasing disability, particularly among women (Bloom, Nandakumar and Bhawalkar 2000) The main argument linking declining disability with increased longevity ... per capita basis, with a ratio of 2.9 (Rannan-Eiya 1999) Similar findings for hospital care in Uruguay in the early 1990s are reported in Micklin et al (1993) A second set of findings has to

Ngày tải lên: 22/03/2014, 13:20

... thrombin-VR1tPA is in agreement with the significant contribution ofthis part ofthe VR1 loop to the binding ofTM by thrombin Binding ofthe carboxy-terminal part ofthe reactive center loop ofPAI-1 in the small ... in cleavage ofthe inhibitor and release ofactive enzyme A decreased overall inhibition rate can thus be the result ofa shift ofthe rate constants ofthe branched part of mechanism, i.e increased ... i.e the rate at which TP disappears in time at steady state after the rapid initial increase The pronounced biphasic character ofthe inhibi-tion profiles in Fig 1A–C is explained by the presteady

Ngày tải lên: 23/03/2014, 17:21

... reductase initiates the reaction, the reaction is almost at a standstill from 6 to 15 min after addition of NADPH Shift of the Soret maximum to 410 nm andappearance of the 534 and 573 nm bands in the ... 210 min, exhibiting the bands of the remaining oxy complex The 340 nm-bandof NADPH decreases in proportion to the decrease of Soret band at 410 nm and to the increases of broadbandspreading 600–700 ... ascorbate (–-–), 4 h after (––), and after the replacement of Ar in the space of the sealedcell with CO (– –). Trang 8appears at 350 and541 nm while the peaks at 534 and686 nm almost disappear

Ngày tải lên: 23/03/2014, 20:22

... monitoring and filtering software Half of the parents participating in this survey answered that they had installed filtering software on the computer that their child used at home Monitoring software ... of the parents say that their child, as far as they were aware, used the Internet in a public place: Slovenia (19%) and Denmark (22%) Q5A As far as you are aware, where does your child access the ... in an online community Downloading/playing games Buying online Spending a lot of time online Using instant messaging tools Downloading/playing films Downloading/playing music Giving out personal

Ngày tải lên: 29/03/2014, 19:20

... from acarbose and barley a-amylase 2 (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of bfia loops 2 and 3 (i.e domain B) from AMY2 (in green) and TAA ... TAA (in black) The superimpositioning was guided by the catalytic acids (D179 AMY2 ,E204 AMY2 ,and D289 AMY2 and D206 TAA ,E230 TAA ,and D297 TAA ) The invariant Y51 AMY2 and Y82 TAA are at subsite ... Superpositioning of AMY2 and TAA guided by corresponding Tyr83 to be involved in activity [60] TAA loop 2 in TAA appeared to hinder binding of the views of AMY2 and TAA complexes (Fig 1B) The enzymatically

Ngày tải lên: 31/03/2014, 08:20

... diseases Conclusion: Chronological tracking of postoperative mRNA levels of inflammatory-related genes in esophageal cancer patients may facilitate early institution of pharamacologic therapy, ... measured using an ELISA kit according to the manufacturer’s instruction (R&D Systems, MN, USA) SOFA was scored according to international criteria [47] Statistical Analysis Clinical parameters and gene ... hypercytokinemia [7] As there are currently no reliable genetic markers for use in ICU care and prognostication, we aimed to determine the clinical value of measuring circulating RNA in the serum of

Ngày tải lên: 18/06/2014, 16:20

... olanzapine and placebo group are shown in Table During acute-phase treatment, a significant improvement was observed in the physical functioning domain of the SF-36 in the olanzapine group During ... Department of Psychiatry, University of British Columbia, Vancouver, Canada Email: Erin E Michalak* - emichala@interchange.ubc.ca; Lakshmi N Yatham - yatham@interchange.ubc.ca; Raymond W Lam ... social functioning, general health, vitality and bodily pain that were significantly improved at the end of the 49-week maintenance phase These findings are in accordance with other research

Ngày tải lên: 20/06/2014, 15:20

... and data evaluation were done on a GC/MSD ChemStation (Agilent, Waldbronn, Germany). The determination of the pharmaceuticals (diclofenac and carbamazepine) in fraction 2 was achieved on a Faber ... of the individual fractions - and in particular in the toxic effects of the moderately polar fracti on 2 were observ ed in the influent of the investigated STP. A significant impact of wastewater ... (Deventer, The Netherlands). For chemical analysis, standard stock solutions of the analytes and the internal standards were prepared both in methanol and hexane and stored at 7°C. The working standard

Ngày tải lên: 20/06/2014, 20:20

... A → B be an injective mapping from A to B. Suppose that m + n ≥ q +1. Then |A τ + B| >q− √ q − 1 2 . In a certain (rather narrow) range of m, n and in the particular case of R induced by an ... particular, for A, B ⊆ Z/pZ and R⊆A × B of given cardinalities we give a sharp estimate for the number of distinct sums a + b with (a, b) /∈R, and we obtain a partial generalization of this estimate ... Secondary: 11P99, 05C25, 05C35. Partially supported by the Edmund Landau Center for Research in Mathematical Analysis and Related Areas, sponsored by the Minerva Foundation (Germany). 1 2 the electronic

Ngày tải lên: 07/08/2014, 06:20

... (S N ). Any automorphism of the un- derlying graph of a Dynkin diagram induces an auto morphism of the Hecke algebra. For the Dynkin diagram of S N , there is exactly one non-trivial auto morphism, ... in [3]. A more general a pproa ch to the representation theory can be taken by approaching the 0-Hecke algebra as a monoid algebra, as per [6]. The main results are reproduced here for ease of ... can see that the 0-Hecke monoid has N! elements, and that the 0-Hecke algebra has dimension N! as a vector space. Additionally, the length of a permutation is the same as the length of the associated

Ngày tải lên: 08/08/2014, 12:23

... this was going on at the dam, a rustling of branches and splashing of water turned the watchers’ attention up-stream Another beaver came in sight, and then another, each partly floating and partly ... nourishment, they were then dragged out again, and floated down to be used in the repair of the dam The other passage, especially adapted to quick exit in case of danger from the way of the roof, was about ... of water against the dam He was apparently heading straight up for the inlet of the pond, on a path which would take him within about twenty-five or thirty yards of the main beaver-house on the...

Ngày tải lên: 06/03/2014, 13:20

... literature involving building and maintaining brand The chapter will also highlight the importance of branding in the marketplace 2.2 What is a Brand? There are many definitions of “brand” Following ... What is the soul of the brand? What are the fundamental beliefs and values that drive the brand? What are the competencies of the organization behind the brand? What does the organization behind ... • • The size and scope of the market; The segment in the market; The players in the market and their positions; The trends in all these areas 10 Market Analysis Market Analysis Market definition...

Ngày tải lên: 13/04/2013, 10:29

... Priorities and hazards for Economies  Variable levels of activity and management capability  Ships’ ballast water and hull fouling are the most important vectors  International shipping, aquaculture ... a role in liaising with IMO, FAO, NACA to enhance the effectiveness of existing instruments within APEC  Institutional arrangements for managing the marine environment is fragmented in most ... Framework  Conclusions, including the results of the November 2001 Workshop Management Framework - Introd uced Marine Pests Management capabilities and approaches  APEC and the MRCWG have a...

Ngày tải lên: 28/10/2013, 11:15

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTTCTAAGGTTTGTAGATGCCGTGGAG TGGGGAGGACTTTTATGCTGT ... iron-dependent Characterization of the kinetic parameters of the enzymatic activity of zebrafish RPE65c To determine the steady-state kinetics of the enzymatic activity of zebrafish RPE65c, the assay conditions...

Ngày tải lên: 14/02/2014, 14:20

... States This vaccine was transferred from a strain that was maintained at the University of Montreal (Montreal, Canada) Vaccine Efficacy Reported rates of the protective efficacy of BCG vaccines ... regarding the risks and benefits associated with both BCG vaccination and TB preventive therapy They should be informed about a) the variable data regarding the efficacy of BCG vaccination, b) the ... National Association of State Public Health Veterinarians Keith A Clark, D.V.M., Ph.D Texas Department of Health Austin, TX National Vaccine Program Anthony Robbins, M.D Office of the Assistant...

Ngày tải lên: 15/02/2014, 13:20