inhead and neck cancer the basics

Progressive resistance training in head and neck cancer patients during concomitant chemoradiotherapy – design of the DAHANCA 31 randomized trial

Progressive resistance training in head and neck cancer patients during concomitant chemoradiotherapy – design of the DAHANCA 31 randomized trial

... exploration into cytokines and mechanisms involved The current paper discusses decisions and methods behind exercise in head and neck cancer patients undergoing concomitant chemoradiotherapy Trial registration: ... carcinoma of the head and neck, scheduled for CCRT are randomized 1:1 to either a 12-week PRT program or control group, both with year follow-up Planned enrollment is 72 patients, and stratification ... ClinicalTrials.gov (NCT02557529) September 11th 2015 Keywords: Head and neck cancer, Head and neck squamous cell carcinoma, Chemoradiotherapy, Progressive resistance training, Exercise, Physical activity,

Ngày tải lên: 06/08/2020, 07:25

11 24 0
Nanoparticle based targeted therapeutics in head-and-neck cancer

Nanoparticle based targeted therapeutics in head-and-neck cancer

... Nanoparticles, targeted therapeutics, head -and- neck cancer, RNA interference, drug delivery, radiosensitization, photothermal therapy Introduction Head -and- neck cancer is the sixth most common cancer worldwide, ... smoking in never drinkers, and the risk of head and neck cancer: Pooled analysis in the international head and neck cancer epidemiology consortium Journal Of the National Cancer Institute 2007; 99: ... In Squamous Cell Carcinoma Of the Head And Neck as a Target for a Novel Nanotherapeutic Drug Head And Neck- Journal for the Sciences And Specialties Of the Head And Neck 2009; 31: 475-81 113 Wang

Ngày tải lên: 15/01/2020, 16:59

14 35 0
Incidence and risk factors for acute kidney injury in head and neck cancer patients treated with concurrent chemoradiation with high-dose cisplatin

Incidence and risk factors for acute kidney injury in head and neck cancer patients treated with concurrent chemoradiation with high-dose cisplatin

... Universiteit, Amsterdam, the Netherlands Department of Otolaryngology-Head and Neck Surgery, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit, Amsterdam, the Netherlands Received: 24 February ... aprepitant on days and 3, and dexamethasone on days to taken orally The use of rescue antiemetics was allowed and reported in the EMR Measurements Demographic and tumor characteristics, tumor and nodal ... values between AKI and non-AKI patients at baseline, and at and 12 months post-treatment Kaplan-Meier and log-rank methods were used to compare the curves of DFS and DSM between AKI and non-AKI patients

Ngày tải lên: 17/06/2020, 18:48

10 22 0
Dietary-phytochemical mediated reversion of cancer-specific splicing inhibits Warburg effect in head and neck cancer

Dietary-phytochemical mediated reversion of cancer-specific splicing inhibits Warburg effect in head and neck cancer

... adaptation of cancer cells The splicing switch from normal PKM1 to cancerspecific PKM2 isoform allows the cancer cells to meet their energy and biosynthetic demands, thereby facilitating the cancer ... glycolysis and the cancer- specific spliced isoform of Pyruvate kinase, PKM2 is known to promote the Warburg effect and therefore facilitates the tumor growth [4, 5] The PKM has two spliced isoforms: the ... results in the inhibition of Warburg effect in terms of reduced glucose-uptake and lactate production and thereby reduced growth, invasion and increased apoptosis of head -and- neck cancer cells The observed

Ngày tải lên: 17/06/2020, 18:58

15 32 0
Feasibility and acceptability of combining cognitive behavioural therapy techniques with swallowing therapy in head and neck cancer dysphagia

Feasibility and acceptability of combining cognitive behavioural therapy techniques with swallowing therapy in head and neck cancer dysphagia

... Research The views expressed are those of the authors and not necessarily those of the NHS, the NIHR or the Department of Health The funding body peer reviewed the study, but had no role in the design, ... acquired and analysed the quantitative data MF and MB acquired and analysed the qualitative data All authors were involved in the interpretation of data and preparation of the manuscript They have ... W, Lefebvre JL Best practices in the management of the psycho-oncologic aspects of head and neck cancer patients: recommendations from the European head and neck cancer society make sense campaign

Ngày tải lên: 23/07/2020, 23:44

11 27 0
MicroRNA-363 targets myosin 1B to reduce cellular migration in head and neck cancer

MicroRNA-363 targets myosin 1B to reduce cellular migration in head and neck cancer

... migration in head and neck cancer and reveal the biological relationship between miR-363, myosin 1b, and HPV-positive SCCHN Keywords: Squamous cell carcinoma of the head and neck, Human papillomavirus, ... JRG, RLF, and SAK conceived and designed experiments BVC, AIW, PA, ACM, JX, and SPG performed the experiments BVC, AIW, PA, ACM, JX, and SAK analyzed the data BVC, AIW, and SAK wrote the manuscript ... RH The molecular biology of head and neck cancer Nat Rev Cancer 2011;11(1):9–22 Stransky N, Egloff AM, Tward AD, Kostic AD, Cibulskis K, Sivachenko A, et al The mutational landscape of head and

Ngày tải lên: 22/09/2020, 23:35

10 14 0
Noncompliance to guidelines in head and neck cancer treatment; associated factors for both patient and physician

Noncompliance to guidelines in head and neck cancer treatment; associated factors for both patient and physician

... BMC Cancer (2015) 15:515 Background Decisions concerning cancer treatment are becoming more complex On the one hand, there is a strong tendency to apply standards and guidelines On the other hand, ... survival rates for cancers in the head and neck area are about 50 % [1] In the majority of cases, treatment consists of surgery, radiotherapy, chemotherapy and combinations of these modalities ... head and neck surgeons, and radiotherapists The treatment proposal was weighed up against the standard treatment protocol, which is based on national guidelines published by the Comprehensive Cancer

Ngày tải lên: 28/09/2020, 10:03

10 10 0
Proteoglycan-based diversification of disease outcome in head and neck cancer patients identifies NG2/CSPG4 and syndecan-2 as unique relapse and overall survival predicting factors

Proteoglycan-based diversification of disease outcome in head and neck cancer patients identifies NG2/CSPG4 and syndecan-2 as unique relapse and overall survival predicting factors

... [2,3], thereby representing the primary lethal cancer entity in patients with head and neck tumours Loco-regional relapsing is the most severe clinical problem encountered in these tumours, while the ... numerous epithelial and non-epithelial tumour types Both PGs produced by the HNSCC cells themselves and PGs associated with the intra-lesional tumour stroma may play critical roles in the control ... dissemination and therapeutic refraction, and may therefore be contemplated as putative biomarkers as well as therapeutic targets There are currently 15 cell surface PGs known in the human genome with the

Ngày tải lên: 29/09/2020, 16:16

19 36 0
Diagnostic value of retrospective PET-MRI fusion in head-and-neck cancer

Diagnostic value of retrospective PET-MRI fusion in head-and-neck cancer

... reference The type and extent of surgical resection of the tumour and the type of the neck dissection was determined by our head -and- neck surgical team on the basis of staging results and estimated ... locoregional tumour and nodal staging of head -and- neck cancer Methods: Thirty-three patients with head -and- neck cancer underwent preoperative contrast-enhanced MRI and PET/ CT for staging The diagnostic ... (LSO) crystals The spatial resolution was 4.4 mm at cm and 5.0 mm at 10 cm from the centre of the transverse FOV (field of view) and the sensitivity was 8.1 kcps/MBq at the centre of the FOV After

Ngày tải lên: 30/09/2020, 15:04

10 21 0
Tumor cells with low proteasome subunit expression predict overall survival in head and neck cancer patients

Tumor cells with low proteasome subunit expression predict overall survival in head and neck cancer patients

... strong clinical [4-6] and preclinical [7-10] evidence for the existence and relevance of cancer stem cells in breast cancer and glioma The cancer stem cell hypothesis received further strong support ... assembly and staining, MH collected and analyzed the clinical data, FP conceived of the study, designed the experiments, analyzed the data and wrote the manuscript All authors read and approved the ... in vitro and in vivo experiments, EV performed the in vitro and in vivo experiments and wrote the manuscript, SB and CL scored the tissue micro arrays, PM and MW were responsible for the TMA assembly

Ngày tải lên: 05/11/2020, 01:29

11 7 0
MicroRNA expression profile in head and neck cancer: HOX-cluster embedded microRNA-196a and microRNA-10b dysregulation implicated in cell proliferation

MicroRNA expression profile in head and neck cancer: HOX-cluster embedded microRNA-196a and microRNA-10b dysregulation implicated in cell proliferation

... to evaluate the difference in gene expression levels between cancer and normal tissue and a statistically significant difference was found between cancer and cancer- free tissue for the expression ... expression and clinical data The authors acknowledge the contribution of the GENCAPO (Brazilian Head and Neck Genome Project) for sample collection, clinical and pathological data collection and interpretation, ... development and progression, and are differentially expressed between normal tissues and cancers [4] Although the function of most of the miRNAs identified to date has yet to be determined, their use

Ngày tải lên: 05/11/2020, 05:32

15 9 0
focal overexpression of ceacam6 contributes to enhanced tumourigenesis in head and neck cancer via suppression of apoptosis

focal overexpression of ceacam6 contributes to enhanced tumourigenesis in head and neck cancer via suppression of apoptosis

... CEACAM6 contributes to cancer formation and its role in head and neck squamous cell carcinoma (HNSCC) remains unclear Therefore, we examined the role of CEACAM6 in head and neck squamous cell carcinoma ... CEACAM6 were made The primers for the first miR RNAi sequence named miR CEA was, 5’ CACTGCCAAGCT CACTATTGAC 3’ for the top strand and bottom strand was 5’ GTCAATAGTGAGTGGCAGTG 3’ The other miR RNAi ... CEA and miR CEA Dux, and was measured by rt PCR (Figure 4A) CEA Dux sequence had the greatest knock down of the sequences, with 96.98% knock down at the mRNA level Using the CEA Dux sequence, the

Ngày tải lên: 02/11/2022, 10:46

11 3 0
Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer

Gene-expression signature regulated by the KEAP1-NRF2-CUL3 axis is associated with a poor prognosis in head and neck squamous cell cancer

... smoking and the reversal of head and neck cancer risk Int J Epidemiol 2010;39(1):182–96 Leemans CR, Braakhuis BJ, Brakenhoff RH The molecular biology of head and neck cancer Nat Rev Cancer 2011;11(1):9–22 ... contributions XT and AN conceived the project; AN, Md-MR, MC and XT analyzed the data and drafted the manuscript; MC had critically read the manuscript; XT edited and reviewed the manuscript All ... therapeutic target in many cancers The exact functions of the other two putative KEAP1-NRF2-CUL3axis-regulated genes, RAB6B and TRIM16L, are unknown in cancer cells and therefore are under investigation

Ngày tải lên: 23/07/2020, 23:49

11 24 0
HSP90 inhibition sensitizes head and neck cancer to platin-based chemoradiotherapy by modulation of the DNA damage response resulting in chromosomal fragmentation

HSP90 inhibition sensitizes head and neck cancer to platin-based chemoradiotherapy by modulation of the DNA damage response resulting in chromosomal fragmentation

... Figs 2, 3, and and in the context of the literature as outlined in the discussion the highest levels of DDR signalling due to CCRT and the highest levels of chromosomal fragmentation with the addition ... KLN, CMN and KJH were funded by Cancer Research UK Programme Grant A13407 AAK was funded by the Wellcome Trust MM and MP were funded by the Oracle Cancer Trust MD was funded by CRUK and The Rosetrees ... MACH-NC Collaborative Group Meta-analysis of chemotherapy in head and neck cancer (MACH-NC): an update on 93 randomised trials and 17,346 patients Radiother Oncol 2009; 92:4–14 Ang KK, Zhang Q, Rosenthal

Ngày tải lên: 20/09/2020, 01:18

13 25 0
New paste for severe stomatitis in patients undergoing head-and-neck cancer radiotherapy and/or chemotherapy with oral appliance

New paste for severe stomatitis in patients undergoing head-and-neck cancer radiotherapy and/or chemotherapy with oral appliance

... treatment by radiotherapy and/ or chemotherapy (hereinafter referred to as “CRT”) for cancer in the head and neck region with severe oral stomatitis Radiotherapy for head and neck cancer has a nearly ... stomatitis derived from radiotherapy and/ or chemotherapy for cancer Keywords: Stomatitis, Head -and- neck cancer, Treatment paste, Denture adhesives, Radiotherapy and/ or chemotherapy Background Multidisciplinary ... adhesives and was developed with the intention of using it in denture-wearing patients In patients with head and neck cancer, severe stomatitis may occur in both the oral cavity and in the pharynx The

Ngày tải lên: 24/07/2020, 01:55

10 20 0
Swallowing interventions for the treatment of dysphagia after head and neck cancer: A systematic review of behavioural strategies used to promote patient adherence to swallowing exercises

Swallowing interventions for the treatment of dysphagia after head and neck cancer: A systematic review of behavioural strategies used to promote patient adherence to swallowing exercises

... swallowing interventions, and to explore any relationships between these strategies and intervention effects Randomised and quasi-randomised studies of head and neck cancer patients were included ... on understanding how and why interventions work in some situations and not others, rather than simply investigating whether they or not work [11] Sutcliffe and colleagues [12] argue the importance ... works to maintain the ability to open the jaw This may extend to information about the impact of radiotherapy on jaw movement and the consequences of doing/not doing the exercise The function category

Ngày tải lên: 20/09/2020, 01:02

15 33 0
G-8 indicates overall and quality-adjusted survival in older head and neck cancer patients treated with curative radiochemotherapy

G-8 indicates overall and quality-adjusted survival in older head and neck cancer patients treated with curative radiochemotherapy

... patients with resectable head and neck cancer Laryngoscope 2007;117(5):835–40 Overgaard J Chemoradiotherapy of head and neck cancer? ??can the bumble bee fly? Radiother Oncol 2009;92(1):1–3 Brugel ... KPC_24 A_025) The authors would like to thank the patients and the staff from the medical oncology, radiation oncology and geriatric departments from the participating hospitals for their contributions ... diagnosis of head and neck cancer? ??a longitudinal study Head Neck 2001;23(2):113–25 Langius A, Bjorvell H, Lind MG Oral- and pharyngeal -cancer patients’ perceived symptoms and health Cancer Nurs 1993;16(3):214–21

Ngày tải lên: 23/09/2020, 00:08

11 17 0
Alterations in anatomic and functional imaging parameters with repeated FDG PET-CT and MRI during radiotherapy for head and neck cancer: A pilot study

Alterations in anatomic and functional imaging parameters with repeated FDG PET-CT and MRI during radiotherapy for head and neck cancer: A pilot study

... head and neck cancer Clin Oncol (R Coll Radiol) 2012;24(7):474–87 Gregoire V, Jeraj R, Lee JA, O’Sullivan B Radiotherapy for head and neck tumours in 2012 and beyond: conformal, tailored, and ... intergroup phase III comparison of standard radiation therapy and two schedules of concurrent chemoradiotherapy in patients with unresectable squamous cell head and neck cancer J Clin Oncol 2003;21(1):92–8 ... radiotherapy is limited This is a hypothesis-generating pilot study to examine the changes on multi-modality anatomic and functional imaging during (chemo)radiotherapy treatment for head and neck

Ngày tải lên: 30/09/2020, 13:07

11 32 0
Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

Báo cáo khoa học: "Early clinical experience with volumetric modulated arc therapy in head and neck cancer patients" ppsx

... radiathion therapy in head and neck cancers: an update Head and Neck 2007, 29:387-400 Popovtzer A, Eisbruch A: Advances in radiation therapy of head and neck cancer Expert Rev Anticancer Ther 2008, ... (being 54.45Gy the low dose, 69.96Gy and 66Gy for the high dose in group A and B, respectively): the larger the difference, the more pronounced the DVH tail to higher doses Findings from the DVH analysis ... described in the Result section, the few cases out of the acceptability level were deeply and critically analyzed and understood before treating the patients To notice is the locations of the failing...

Ngày tải lên: 09/08/2014, 09:20

10 386 0
Báo cáo khoa học: " IMRT using simultaneously integrated boost (SIB) in head and neck cancer patients" pps

Báo cáo khoa học: " IMRT using simultaneously integrated boost (SIB) in head and neck cancer patients" pps

... GS and CG designed the study and analysed the data, GS carried out the data collection and drafted the manuscript PH participated in collecting data and created the data base BD reviewed and ... corrected the manuscript, BD and GK participated in drafting the 'methods' UML reviewed and corrected the manuscript All authors read and approved the final manuscript The authors are the responsible ... definitive and postoperative IMRT for head -and- neck cancer Int J Radiat Oncol Biol Phys 2003, 55:312-321 Puri DR, Chou W, Lee N: Intensity-modulated radiation therapy in head and neck cancers:...

Ngày tải lên: 09/08/2014, 10:20

15 337 0
w