improving lysine content using plant gene transfer

... phosphinothricin acetyltransferase (bar) genes can also be quantified using radiochemtcal assays (22,23) Selectable Marker Genes A selectable marker gene is used to recover transformants after a gene transfer ... phosphotransferase gene m maize plants Plant Mol Btol 18, 189-200 33 Gritz, L and Davtes, J (1983) Plasmid-encoded hygromycin B resistance* the sequence of hygromycm B phosphotransferase gene and ... genes (see Chapters l&12), mammalian genes that code for immunoglobulins (5) or viral genes that code for coat proteins (6) Numerous plant genes cloned in dicot or monocot species have been transferred...

Ngày tải lên: 11/04/2014, 10:10

... AMPK and the full length human MCD in H9c2 cells (a rat cardiac ventricular cell line) using an adenoviral gene delivery technique As MCD is localized in various subcellular compartments, we also ... transferred to a glass-Teflon homogenizer (Potter-Elvehjem, between 0.10 and 0.15 mm clearance), and homogenized by 10–15 up and down strokes while revolving at 500 r.p.m Homogenate was then transferred ... counter The radioactivity was converted to nanomoles of acetyl-CoA formed in the reaction using a standard curve generated from to 20 nM range of standard acetyl-CoA which underwent similar treatment...

Ngày tải lên: 16/03/2014, 16:20

... http://arthritis-research.com /content/ 12/6/R220 contractor (Millipore, Billerica, MA, USA) using Luminex® platform Intracellular cytokine staining and flow cytometric analysis Spleens were freshly explanted, gently ... http://arthritis-research.com /content/ 12/6/R220 Data presented in the results are from slides using 1:40 dilutions of sera from each experimental group Statistical analyses Statistical evaluations were determined by using ... Local adeno-associated virus-mediated interleukin 10 gene transfer has disease-modifying effects in a murine model of Sjogren’s syndrome Hum Gene Ther 2003, 14:1605-1618 27 Kok MR, Voutetakis A,...

Ngày tải lên: 12/08/2014, 15:22

... of alignments are generated We then proceeded to evaluate our Exit-point methodology from these alignments 6.1 Synthetic Datasets The synthetic datasets were generated by implanting some motif ... 2006, 1:23 http://www.almob.org /content/ 1/1/23 Table 3: Improvements in the Performance Coefficient Motif (l, d) PC obtained using Random Projection PC obtained using Exit-point method (11,2) ... http://www.almob.org /content/ 1/1/23 original local maximum The ascent stage is used to ensure that the new guess is in a different convergence zone Hence, given the best local maximum obtained using any...

Ngày tải lên: 12/08/2014, 17:20

... sperm-mediated gene transfer Transplant Proc 1999; 31(1-2):972-974 42 Lazzereschi D, Forni M, Cappello F, et al Efficiency of transgenesis using sperm-mediated gene transfer: Generation of hDAF ... future generations, difficulties of distinction between gene therapy and genetic enhancement, and the spectre of eugenics [1, 2, 3] Thus, human germline genetic modification is far more ethically contentious ... to Human Germline Gene Therapy An ideal gene transfer system in the context of human germline gene therapy would have the following features: (a) the ability to deliver transgenes in a highly...

Ngày tải lên: 03/11/2012, 10:01

... +44 (0)20 8849 2275 E innovation.development@cimaglobal.com  Improving cash flow using credit management Contents Improving cash flow using credit management − the outline case Working capital ... overtrading: a case study 25 Conclusion 26 Further reading 27  Improving cash flow using credit management Improving cash flow using credit management – the outline case Cash flow is the life ... company registration and VAT reference 10 Improving cash flow using credit management Send the invoice to a named individual Electronic invoices, sent by email or using internet based systems, are becoming...

Ngày tải lên: 15/02/2014, 14:20

... each of the intervening candidates Based on the training instances, a binary classifier is generated using a certain learning algorithm, like C5 (Quinlan, 1993) in our work During resolution, ... were preprocessed using the same POS tagging and NE-recognition components as in the pronoun resolution task Cass (Abney, 1996), a robust chunker parser was then applied to generate the shallow ... resolution: the best gains using the corpus-based and the web-based semantic features under TC are 2.9% and 5.3% respectively, higher than those under the SC model using either un-normalized...

Ngày tải lên: 20/02/2014, 15:20

... listed in Table using a Genetic Algorithm (GA) GAs are categorized as global search heuristics Figure shows a simplified GA flowchart A typical genetic algorithm requires (1) a genetic representation ... first to make an attempt at using graphbased ranking methods in single document extractive summarization, generating similarity links between document paragraphs and using degree scores in order ... to the next generation Reproduction In this stage, new genes/solutions are introduced into the population, i.e., new points in the search space are explored These new solutions are generated from...

Ngày tải lên: 07/03/2014, 22:20

... E1A gene transfer suppressed dissemination of ovarian cancer cells that overexpress HER-2/neu Oncogene 11: 1383 – 1388 Hortobagyi, G N., et al (2001) Cationic liposome-mediated E1A gene transfer ... Tumor-specific gene therapy for uterine cervical cancer using MN/CA9-directed replication-competent adenovirus Cancer Gene Ther 11: 532 – 538 110 Rein, D T., et al (2004) Gene transfer to cervical ... HOXA10 gene are infertile because of implantation failure [82] More importantly, defects in endometrial HOX gene expression in infertile women have been demonstrated [82] Thus, augmenting HOX gene...

Ngày tải lên: 22/03/2014, 11:20

... effect on Morquio gene transfer 48 Vargas J Jr, Gusella GL, Najfeld V, Klotman ME & Cara A (2004) Novel integrase-defective lentiviral episomal vectors for gene transfer Hum Gene Ther 15, 361–372 ... C & Mannoni P (2000) Gene transfer to hepatocellular carcinoma: transduction efficacy and transgene expression kinetics by using retroviral and lentiviral vectors Cancer Gene Ther 7, 1286–1292 ... sulfatase-deficient LSDs, the coexpression of a sulfatase gene together with the sulfatase-modifying factor Promoter and SUMF1 effect on Morquio gene transfer (SUMF1) gene has permitted a two-fold to three-fold...

Ngày tải lên: 29/03/2014, 21:20

... 19 Gutted Adenoviral Vectors for Gene Transfer to Muscle Jeannine M Scott and Jeffrey S Chamberlain Introduction Adenoviral vectors are a popular choice for gene transfer protocols because they ... describes the methods used by our laboratory for generating, expanding, and titering gutted adenoviral vectors for gene transfer to muscle 1.1 General Features of Gutted Adenoviral Vectors The ... without further truncations to the therapeutic genes Several recent research breakthroughs have made rAAV-mediated gene therapy for larger genes (therapeutic genes larger than kb) a viable reality Studies...

Ngày tải lên: 10/04/2014, 11:11

... MIS, and allogeneic MHC by transfer of T-cell receptor cx-and @hain genes Nature 336,580-583 Toneguzzo, F., Keating, A., Glynn, S., and McDonald, K (1988) Electric field-mediated gene transfer: ... Parameters governing the transfer of the genes for the thymidine kinase and dihydrofolate reductase into mouse cells using metephase chromosomes or DNA Somatic Cell Genet 6, 333-348 15 Faber, ... resistance gene by transcriptional and translational fusion and by DNA sequencing Nuckk Acids Res 11,6895-6911 hAPTER Xkansfection of the ChloramphenicolAcetyltransferase Gene into Eukaryotic Cells Using...

Ngày tải lên: 11/04/2014, 09:42

... which involves many susceptibility genes Disease-causing mutations can be broadly classified into two groups: those causing a significant change in chromosome or gene structures (e.g., large deletions, ... the results using the manual heteroduplex analysis to screen a 330 bp DNA fragment of the apo AI gene Slower bands correspond to heteroduplex generated by a mutation in the apo AI gene that has ... (1989) A PCR artifact: Generation of heteroduplexes Am J Hum Genet 45, 337–339 Mapping Human Genes 25 Radiation Hybrid (RH) Mapping of Human Smooth Muscle-Restricted Genes Joseph M Miano, Emilio...

Ngày tải lên: 11/04/2014, 10:39

... 4tat exhibited enhanced gene transfer efficacy in a variety of tumor cells Ad5.PTD Ad5.PTDtat exhibited enhanced gene transfer efficacy in a variety of tumor cells Gene transfer efficacy was evaluated ... Journal 2007, 4:103 Enhanced gene transfer efficacy of Ad5.PTDtat We further investigated the gene transfer efficacy of Ad5.PTDtat in a variety of cultured cells using the reporter GFP protein ... http://www.virologyj.com /content/ 4/1/103 In vivo gene transfer efficacy of Ad5.PTDtat We next examined whether the infectivity-enhanced vector Ad5.PTDtat could deliver enhanced gene transfer efficacy...

Ngày tải lên: 18/06/2014, 18:20

... disease in dystrophic mice following local gene transfer [43] Conclusions Our results here have opened a new avenue to treat DMD cardiomyopathy using AAV SERCA2a gene delivery Future studies in aged ... software (SPSS, Chicago, IL) using one-way ANOVA followed by Bonferroni post hoc analysis Difference was considered significant when P < 0.05 Results AAV-9 mediated SERCA2a gene transfer in old mdx mice ... corresponds to the mouse CFTR gene intron (DL1287, 5’- TGCATCACTTTTAAATGGAACCTC) The expected mouse CFTR gene amplicon size is 160 bp Histopathology examination General heart histology was evaluated...

Ngày tải lên: 18/06/2014, 22:20

... mechanism In contrast to the adverse effects of intra-articular adenoviral gene transfer of TGF-β1, we have shown that gene transfer of insulin-like growth factor type to the rabbit knee results ... by ex vivo gene transfer Proc Natl Acad Sci USA 1993, 90:10764-10768 15 Watanabe S, Imagawa T, Boivin GP, Gao G, Wilson JM, Hirsch R: Adeno-associated virus mediates long-term gene transfer and ... JE, Evans CH, Robbins PD: Direct retrovirus-mediated gene transfer to the synovium of the rabbit knee: implications for arthritis gene therapy Gene Ther 1997, 4:977-982 17 Mi Z, Ghivizzani SC, Lechman...

Ngày tải lên: 09/08/2014, 01:21

... study of IL-1Ra gene therapy in RA [19] was recently successfully completed During the preclinical development of IL-1Ra gene therapy, we often noticed that transfer of the IL-1Ra gene provided ... antagonist protein using a new strategy of direct Available online http://arthritis-research.com /content/ 5/5/R301 16 17 18 19 20 21 22 23 24 25 26 27 28 adenoviral-mediated gene transfer to skeletal ... IL-1Ra locally to joints via ex vivo gene transfer There exist several possible explanations for the improved effectiveness of IL-1Ra when delivered as a gene rather than as a recombinant protein...

Ngày tải lên: 09/08/2014, 01:23

... for significance using the Mann–Whitney U test P values

Ngày tải lên: 09/08/2014, 06:22