implication of hybrid states for migration and survival in development a

Báo cáo khoa học: Selectivity of pyruvate kinase for Na+ and K+ in water/dimethylsulfoxide mixtures docx

Báo cáo khoa học: Selectivity of pyruvate kinase for Na+ and K+ in water/dimethylsulfoxide mixtures docx

... lactate dehydrogenase The concentrations of Na+ and K+ were varied as indicated and (CH3)4NCl was added in each case to give a final salt concentration of 100 mM in order to maintain constant ... detection (10 lM) Assay of pyruvate kinase activity The formation of pyruvate was measured at 25 °C in a coupled system with lactate dehydrogenase and NADH [30] In water or in the binary water/dimethylsulfoxide ... Swann, A. C & Albers, R.W (1975) Sodium-potassium-activated ATPase of mammalian brain regulation of phosphatase activity Biochim Biophys Acta 382, 437–456 Swann, A. C (1983) Brain (Na+, K+)-ATPase...

Ngày tải lên: 08/03/2014, 02:20

9 463 0
báo cáo khoa học: " Complete chloroplast genome of Oncidium Gower Ramsey and evaluation of molecular markers for identification and breeding in Oncidiinae" pot

báo cáo khoa học: " Complete chloroplast genome of Oncidium Gower Ramsey and evaluation of molecular markers for identification and breeding in Oncidiinae" pot

... TCAAGTATTCCATTTCACCA 113319 1828 ndhB 437 TGATCTGGCATGTACAGAATG 438 AAAGAGGGTATCCTGAGCAA 133250 2221 trnHGUG-psbA 460 AAGCGTCCTGTAGTAAGAGGA 476 GGGAAACCACTGAAAATGAG 145562 1426 accD 423 TGGTTCAATTCAATGTTGTCT ... 424 ATTCAAGGGAAGGAAACCGT 55778 1430 matK 1785 TCTAGCACACGAAAGTCGAAGT 1784 CGATCTATTCATTCAATATTTC 1931 936 trnFGAA-ndhJ 529 TCGGGATAGCTCAGTTGGTA 107 GTTTCTGCTTCACGAATATG 47650 1379 rbcL 505 AGGGAGGGACTTATGTCACCA ... TGAAATTGGTAGACACGCTGC 1059 ACCGAAGATTGTGTAGGTTG 109333 2728 psaC-ndhE-ndhG 1058 TGCTCGGGAGAAGAATAATA 1061 TTTGTGGGAACCATAAATGT 111849 1697 ndhG-ndhI-ndhA-ndhH 1095 TGAATACCAATTTGTTGAACG 1917 TCAAGTATTCCATTTCACCA...

Ngày tải lên: 12/08/2014, 03:21

12 341 0
Báo cáo hóa học: " Research Article On Strong Convergence by the Hybrid Method for Equilibrium and Fixed Point Problems for an Inifnite Family of Asymptotically Nonexpansive Mappings" potx

Báo cáo hóa học: " Research Article On Strong Convergence by the Hybrid Method for Equilibrium and Fixed Point Problems for an Inifnite Family of Asymptotically Nonexpansive Mappings" potx

... Fixed point iteration processes for nonexpansive mappings and asymptotically nonexpansive mappings in Hilbert spaces and Banach spaces including Mann 11 and Ishikawa 12 iteration processes have been ... nonexpansive mappings and asymptotically nonexpansive mappings is an important subject in nonlinear operator theory and its applications, in particular, in image recovery and signal processing see, ... “Construction of fixed points of nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 20, pp 197–228, 1967 F Liu and M Z Nashed, “Regularization of nonlinear ill-posed...

Ngày tải lên: 21/06/2014, 20:20

20 275 0
Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation

Different physical and chemical pretreatments of wheat straw for enhanced biobutanol production in simultaneous saccharification and fermentation

... chemical pretreatments are acidic, alkaline, and water pretreatment Sulfuric acid and monoethanolamine (MEA) are applied as catalysts during acid and alkaline pretreatment No catalysts are applied ... Alkaline pretreatment and saccharification was examined by adding 3.3 g of wheat straw in 100 ml monoethanolamine solution in a 200 ml shaker flask The monoethanolamine concentration was varied ... concentration was increased during saccharification with cellulase and βglucosidase only (i.e absence of xylanase) This implied that xylanase interacted with cellulase and βglucosidase and allowed similar...

Ngày tải lên: 05/09/2013, 15:28

12 377 0
Tài liệu Dictionary of Applied Math for Engineers and Scientists doc

Tài liệu Dictionary of Applied Math for Engineers and Scientists doc

... an arrangement of statistical data in order of increasing (or decreasing) magnitude array index In a rectangular array such as a matrix the element in the ith row and j th column is indexed as ... a dynamic variable taking a continuum of values, e.g., a timepiece having hour and minute hands analog computation Instead of using binary computation as in a digital computer, one uses a device ... ; A) which has an affine space A as a standard fiber and transition functions acting on A by means of affine transformations If the base manifold is paracompact then any affine bundle allows global...

Ngày tải lên: 10/12/2013, 12:15

149 718 2
Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

Tài liệu Investigation of Organic Chemicals Potentially Responsible for Mortality and Intersex in Fish of the North Fork of the Shenandoah River, Virginia, during Spring of 2007 ppt

... of the same models to determine ambient water concentrations Previous data indicate that many chemicals of interest remain in the linear phase of sampling for at least 56 days (Alvarez and others, ... sampler Data that are greater than the MDL, but less than the MQL, are shown in italics Any data less than the MQL have a large degree of statistical uncertainty and are presented for informational ... intersex in fish have been increasing in regularity in the Shenandoah River and Potomac River basins in Virginia (Blazer and others, 2007) The fish kills and observations of intersex primarily have...

Ngày tải lên: 14/02/2014, 08:20

24 865 0
Tài liệu Management of continual improvement for facilities and activities: A structured approach doc

Tài liệu Management of continual improvement for facilities and activities: A structured approach doc

... respect can greatly reduce, if not eliminate, fear and anxiety about impending changes Involving employees as equal participants in planning and decision-making increases understanding, creates ownership ... management approach such as that advocated by IAEA Safety Standards, ISO 9001, Malcolm Baldridge National Quality Award and European Foundation for Quality Management Business Excellence model; The alignment ... Understanding and supporting management expectations and policy; Respecting the staff while communicating and implementing management expectations and policy; and, Practicing exemplary leadership...

Ngày tải lên: 18/02/2014, 11:20

78 1,6K 0
Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

Tài liệu Báo cáo khoa học: Implication of the glutamine synthetase ⁄glutamate synthase pathway in conditioning the amino acid metabolism in bundle sheath and mesophyll cells of maize leaves doc

... 5Â-CTCATATGCCATGATCTCATCG-3Â, L-FNR (AB035644): forward primer, 5Â-ACAACACAAAATGTCAGCTGC AAAA-3Â; reverse primer, 5Â-AAGGCCAAGAAGGAGTC CAAGAAG-3Â; L-FNR (AB035645): forward primer, 5Â-TTGCTTGAGCTGAACAATACAATGAA-3Â; reverse ... sap (Fig 7), suggesting that there was little contamination from xylem, and vice versa Glx (glutamine and glutamate: ve carbon amide and amino acid) and Asx (asparagine and aspartate: four carbon ... function of each gene have been elucidated in part [24] Ammonium and glutamine-amide group are also assimilated into asparagine by asparagine synthetases (ASs; ammonia ligase AS, EC 6.3.1.1; glutamine...

Ngày tải lên: 18/02/2014, 18:20

14 567 0
Tài liệu Integrated Management of Childhood Illness Caring for Newborns and Children in the Community doc

Tài liệu Integrated Management of Childhood Illness Caring for Newborns and Children in the Community doc

... than days) in a malaria area Advise the caregiver to give more fluids and continue feeding Do a rapid diagnostic test (RDT) If RDT is positive, give oral antimalarial AL (Artemether-Lumefantrine) ... oral antimalarial AL: Age months up to years—1 tablet Age years up to years—2 tablets If fast breathing or chest indrawing, give first dose of oral antibiotic (amoxycillin tablet—250 mg): Age ... Library Cataloguing -in- Publication Data: Integrated management of childhood illness: caring for newborns and children in the community v Contents: Manual for the community health worker Facilitator...

Ngày tải lên: 21/02/2014, 14:20

14 579 0
The Health Benefits of Physical Activity for Girls and Women ppt

The Health Benefits of Physical Activity for Girls and Women ppt

... well-being of girls and women in a holistic and fundamental way This is the starting point for the development of a richer understanding of the links between physical activity and the health and ... empowerment, and individual and community capacity This linkage underscores the potential for an interdisciplinary perspective, incorporating quantitative and qualitative research from a variety of research ... the value of regular physical activity in preventing and treating many physical and mental health concerns and diseases The association of low physical fitness with an increased risk of mortality...

Ngày tải lên: 05/03/2014, 13:20

214 560 1
Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

... pages 159170 Carl Pollard and Ivan A Sag 1987 Information-Based Syntax and Semantics Vol I: Fundamentals CSLI Lecture Notes, Number 13 Center for the Study of Language and Information, Stanford ... dialogues are real world dialogues about appointment scheduling and vacation planning They contain a variety of syntactic as well as spontaneous speech phenomena The remaining half of the English ... 20 and 120 unary and binary rule schemata Since all rule schemata in our system bear a unique number, this filter can be realized as a three dimensional boolean array Thus, access costs are minimized...

Ngày tải lên: 08/03/2014, 06:20

8 340 0
In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

In Vitro Screening of Plant Resources for Extra-Nutritional Attributes in Ruminants: Nuclear and Related Methodologies pptx

... (Western Australia South Australia, Victoria and New South Wales) was extracted from a range of state-based and national plant databases and compiled into an Access database These databases principally ... Geographic Information System mapping and spatial analysis can be a powerful tool in this process, allowing spatial mapping of major factors that will in uence adaptability including climate, soil ... development of a computer-based database is a critical step in the process providing the capacity to systematically capture the scattered information available and keep track of the originating...

Ngày tải lên: 15/03/2014, 04:20

252 4,5K 0
Woody Biomass for Bioenergy and Biofuels in the United States— A Briefing Paper doc

Woody Biomass for Bioenergy and Biofuels in the United States— A Briefing Paper doc

... generated as part of a hazard-fuel thinning program may offer the greatest volumes of material available and not currently used However, handling and transport of this material is costly, and ... discarded into landfills In MSW, woody biomass can be found in paperboard and paper waste, discarded wood products such as furniture, durable goods, crates and packaging, and in yard trimmings In ... reduction of sawtimber material in eastern Oregon, Adams and Latta (2005) found that the form and application of the subsidy had important implications for the number of acres treated as well as the...

Ngày tải lên: 18/03/2014, 02:20

56 546 1
APPLICATIONS OF ION CHROMATOGRAPHY FOR PHARMACEUTICAL AND BIOLOGICAL PRODUCTS pptx

APPLICATIONS OF ION CHROMATOGRAPHY FOR PHARMACEUTICAL AND BIOLOGICAL PRODUCTS pptx

... anions in pharmaceuticals 10 DeBorba BM, Rohrer JS, Bhattacharyya L Development and validation of an assay for citric acid/citrate and phosphate in pharmaceutical dosage forms using ion chromatography ... Slovenia s c Paul R Haddad Australian Centre for Research On Separation Science (ACROSS), School of Chemistry, Faculty of Science and Engineering, University of Tasmania, Hobart, Tasmania, Australia ... anion-exchange chromatographic supports to separate ionic, polar, weakly polar, and apolar analytes, and has been used in the analysis of organic acids, alcohols, glycols and sugars In contrast to...

Ngày tải lên: 22/03/2014, 09:20

455 420 1
Improving the Quality of Health Care for Mental and Substance-Use Conditions doc

Improving the Quality of Health Care for Mental and Substance-Use Conditions doc

... transparent to patients and their caregivers SUMMARY 13 • Obtaining the best available comparative information on safety, effectiveness, and availability of care and providers, and using that information ... proofreading and manuscript preparation assistance Finally, we thank the Annie E Casey Foundation, CIGNA Foundation, the National Institute on Alcohol Abuse and Alcoholism (NIAAA), the National ... University of Cincinnati College of Medicine, and CEO of Alliance Behavioral Care BENJAMIN DRUSS, Rosalynn Carter Chair in Mental Health, Emory University, Atlanta SAUL FELDMAN, Chairman and Chief...

Ngày tải lên: 22/03/2014, 16:21

529 333 0
BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

BENEFITS OF E-CRM FOR BANKS AND THEIR CUSTOMERS pdf

... Sverige and Föreningsbanken 1997 Hansabank acquired a stake in Hoiupank 1999 Swedbank acquired more than 50% of Hansabank in year 2002 Hansabank started operations in Russia 2004 Hansabank acquired ... (Mosad, 1995) Employees who are friendly and cooperative and careful at handling customer’s data availability of customers’ information and staff for assistance 45 DATA ANALYSIS Trust Michael ... Interaction and Satisfaction Oladunga showed lot of interest about his interaction and satisfaction with the bank His response was that internet banking is the main way of interacting with bank...

Ngày tải lên: 22/03/2014, 21:20

73 712 0
ACCELERATING TECHNOLOGY TRANSITION Bridging the Valley of Death for Materials and Processes in Defense Systems potx

ACCELERATING TECHNOLOGY TRANSITION Bridging the Valley of Death for Materials and Processes in Defense Systems potx

... should lead a national, multiagency initiative in computational materials engineering to address three broad areas: methods and tools, databases, and dissemination and infrastructure • Methods and ... survivability, while offering significant capital, operating, and maintenance cost savings Although initial costs may be higher for an accelerated development path, an overall cost savings and a faster return ... BOARD ON MANUFACTURING AND ENGINEERING DESIGN PAMELA A DREW, The Boeing Company, Chair CAROL ADKINS, Sandia National Laboratories GREGORY AUNER, Wayne State University THOMAS W EAGAR, Massachusetts...

Ngày tải lên: 28/03/2014, 11:20

69 535 0
The Role of Consulting Psychiatrists for Obstetric and Gynecologic Inpatients pptx

The Role of Consulting Psychiatrists for Obstetric and Gynecologic Inpatients pptx

... diagnosis and treatment recommendations in each case are reevaluated and confirmed in this meeting 58 consultation records was performed, and the data collected included baseline data (age and ... and marital status), physical diagnosis, psychiatric diagnosis, reasons for referral, and intervention recommended Psychiatric diagnoses were based on the Diagnostic and Statistical Manual of Mental ... gynecology departments have also been noted in Western studies,(12,15,16) and Tsai and colleagues reported a 0.3% referral rate for obstetric inpatients in Taiwan.(14) Although our data included gynecologic...

Ngày tải lên: 28/03/2014, 14:20

8 362 0
w