... the epigenetic memory of winter. Plant Cell 16, 255 3– 255 9. Baurle, I., and Dean, C. (2006). The timing of developmental transitions in plants. Cell 1 25, 655 –664. Becker, A., and Theissen, G. (2003). ... Laboratory, Dr. Hou Xingliang, Lee Lin Yen Candy, Li Dan, Liu Chang, Xi Wanyan, Tao Zhen, Wang Yue, Liu Lu, Thong Zhong Hui and Yan Yuan Yuan. I also want to thank the honors student Kang Yin Ga Germain ... SOC1:GUS (D) and its mutated constructs M1 (E) and M2 (F). (G and H) GUS staining of the shoot apex of 12-day-old transformants containing SOC1:GUS (G) and M1 (H). (I and J) GUS staining of the cotyledons...
Ngày tải lên: 11/09/2015, 10:02
... Synthesis And Characterization Of Group Metal Complexes Containing Pyrazolate, Amidate, And Related Ligands As Potential Precursors For Thin Film Growth By Atomic Layer Deposition Thuduwage Hiran Perera ... University, Follow this and additional works at: http://digitalcommons.wayne.edu/oa_dissertations Recommended Citation Perera, Thuduwage Hiran, "Synthesis And Characterization Of Group Metal Complexes ... "Synthesis And Characterization Of Group Metal Complexes Containing Pyrazolate, Amidate, And Related Ligands As Potential Precursors For Thin Film Growth By Atomic Layer Deposition" (2012) Wayne...
Ngày tải lên: 22/10/2022, 21:04
Identification and characterization of novel group 5 and group 21 allergens from dust mite and ige binding epitope mapping of blo t 5
... profiles of 11 Group 5 and Group 21 allergens 149 6.2 .5 Cross-reactivity of Group 5 and Group 21 allergens 153 6.2 .5. 1 6.3 153 6.2 .5. 2 6.2.6 Cross-reactivity of ... Der f 5 116 5. 2.4 Secondary structures of Der f 21 and Der f 5 118 5. 2 .5. .. predominant sensitization of Group 5 and Group 21 allergens of B tropicalis and D ... Immuno-localization 50 2 .5. 11 Dust sample collection and processing 50 2 .5. 12 Measurement of allergen in dust samples 50 Statistical analyses Chapter 3: 51 52 Identification and Characterization of...
Ngày tải lên: 14/09/2015, 12:44
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx
... for the identification and characterization of viral genomes Timothy M Rose* Address: Department of Pathobiology, Box 357 238, School of Public Health and Community Medicine, University of Washington, ... Design, conception and preparation of the manuscript (TMR) Acknowledgements The author would like to thank Emily Schultz, Greg Bruce, Lin Bennet, Brian Raden, Jon Ryan, and Kurt Strand for their help ... Gessain A: Simian Homologues of Human http://www.virologyj.com/content/2/1/20 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 Gamma-2 and Betaherpesviruses in Mandrill and Drill Monkeys...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx
... between 45? ?C and 55 °C with half-life of 60 and 20 min respectively (Figure 7). Effects of metal ions and additives The AS-protease activity was estimated in the presence of metal ions (5 mM) and different ... 6 of 10 different temperatures ( 35? ?C, 45? ?C and 55 °C) in the presence of 5 mM CoCl 2 and activity was measured at 42°C. The AS-protease was stable a t 35? ?C for 60 min. However, the stability of ... at 42°C (Figure 6B) but exhibited only 65 and 85% of the maximum activity at the tem- perature range of 35? ?C and 55 °C respectively. Thermal stability of the purified AS-protease was estimated...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Design and Characterization of a 5.2 GHz/2.4 GHz ΣΔ Fractional-N Frequency Synthesizer for Low-Phase Noise Performance" potx
... noise, that is, the contributor of the synthesizer out -of- band noise, one for the ΣΔ modulator noise that could contribute to both in-band and out -of- band noise, and one for all other noise sources ... expensive fabrication The measured integrated phase noise of the WLAN synthesizer was 0 .5? ?? rms for the lower band and 0 .53 5◦ rms for the upper band and that is close to the predicted phase noise These ... CMOS It was designed for multiband WLAN applications, and had a reference frequency of 40 MHz, a fairly standard charge pump and PFD configuration with gain Kphase of 750 μA/2π, a multimodulus divider...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps
... nM; lane 3, 25 nM; lane 4, 12 .5 nM; lane 5, 6. 25 nM; lane 6, 3.12 nM), or with vehicle (lane 7), or with increasing concentrations of Hh-Ag 1.2 (agonist; lane 8, 15 nM; lane 9, 31. 25 nM; lane ... Jessell and Phillip Beachy for comments on the manuscript Shh-, Smo- and Ptc-transgenic lines were graciously provided by the labs of Andrew McMahon and Matthew Scott We thank James Chen and Phillip ... Hh-protein ligand has therapeutic value [49 ,50 ] On the basis of our current understanding of these models and the specific mechanism of action of the Hh agonists, we predict that an agonist-derivative...
Ngày tải lên: 06/08/2014, 18:20
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc
... amino-acid sequence of CaNDR1a (Figure 4), with resi- dues S189 and G190 being strong ω-site candidates (with P-values of 2.48 × 10 -6 and 2.76 × 10 -5 , respectivel y). Furthermore, CaNDR1a and its Arabidopsis ... of transgene transcripts and three of them were selected for further experiments. The expression level of CaNDR1a in these lines, designated T3-1, T3-2 and T3-3, was respectively 92-, 190-, and ... weight of 23.8 kDa and an isoelectric point of 9 .58 . Searching for Arabidopsis relatives of our proteins, we screened the GenBank database by means of the BLAST P algorithm [26] and retrieved 15 non-redundant...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterization of wheat long non-protein coding RNAs responsive to powdery mildew infection and heat stress by using microarray analysis and SBS sequencing" ppsx
... (Additional file 7) and amplified the antisense strand sequences of TalnRNA9 and TalnRNA12 (anti-TalnRNA9 and anti- TalnRNA12) It was found that expression levels of TalnRNA9 and TalnRNA12 were ... to SRP1 and SRP3 7S RNA variants are categorized to groups according to their locations, most members of group I, II, and III match both TalnRNA9 and TalnRNA12, and other two (group IV group V) ... proteinase K and DNA was extracted and dissolved in 50 μl of ddH2O Additional file 6: Categories of siRNAs corresponding to SRP1 and SRP3 7S RNA variants and sequences of SRP1 and SRP2 corresponding siRNAs...
Ngày tải lên: 11/08/2014, 11:21
báo cáo khoa học: " Identification and characterization of flowering genes in kiwifruit: sequence conservation and role in kiwifruit flower development" ppt
... identified markers for flower development, and candidates for manipulation of kiwifruit growth, phase change and time of flowering. The expression in normal and aberrant flowers provided a model for kiwifruit ... plants, and additional models have been pro- posed [55 -57 ]. Evolutionary developmental biology of MADS box genes in a range of angiosperms has been instrumental in the development and testing of ... [reviewed in 58 ] and further broad compara tive studies, including normal and aberrant flowers in a range of species, will aid understanding of the mechan- isms underlying the variation in angiosperm...
Ngày tải lên: 11/08/2014, 11:22
báo cáo khoa học: " Identification and characterization of plant Haspin kinase as a histone H3 threonine kinase" ppsx
... Page 7 of 14 was expressed in meristems and primordia of root tips, lateral roots (Figures 5C and 5D), the shoot apex, leaf (Figures 5E-5H), and flowers (Figures 5I-5K). Fluores- cent signals of ... Lys4, Ser10, and Gly12). Using anti-H3T3ph antibodies, bands were detected in the case of normal histone H3 and S10A, T11A, and G12A mutants, but not in the case of R2A, T3A, or K4A mutants (Figure ... in plants (Figures 4A and 4B). Thus, the localization and timing of histone H3 SerandThrphosphorylation during mitosis differ between plants and animals. However, the fact that Has- pin and Aurora...
Ngày tải lên: 11/08/2014, 11:22
Báo cáo y học: "Identification and characterization of duck plague virus glycoprotein C gene and gene product" docx
... 388.0234 2 .59 28 h 11.3 24 .5 17.9 13.7 -17.4 172 950 .5 5.24 36 h 11.9 24 .5 18 .5 13.7 -17.4 172 950 .5 5.24 54 h 14.4 24 .5 19.8 13.7 -16.2 752 81.1 4.88 72 h 18.9 24 .5 24 13.7 - 15. 9 61147. 25 4.79 Lian et ... molecule, and the two glycoproteins, gC and gE, have a synergistic effect on mediating immune evasion[30,31]. And gC of HSV- 1and- 2,BHV-1,PRV,andEquineherpesvirus types 1 and 4 (EHV-1 and -4) has ... 273 :50 47 -50 52. 24. Li Y, van Drunen Littel-van den Hurk S, Babiuk LA, Liang X: Characterization of cell-binding properties of bovine herpesvirus 1 glycoproteins B, C, and D: identification of...
Ngày tải lên: 12/08/2014, 02:20
Báo cáo y học: "A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements" potx
... 2006Wang and ZhangVolume 7, Issue 6, Article R49 Method A steganalysis-based approach to comprehensive identification and characterization of functional regulatory elements Guandong Wang * and ... up strand, (-) if on the down strand or (*) if on both strands. Rank is based on Z g -score and G-score, where the first number is the ranking on Z g -score and the second is on G-score and the ... motifs of Ace2/Swi5 and Met4/Met28 with high G-score ranking, and the binding motifs of Mcm1 and Ste12 with high Z g -score ranking. Figure 3 displays the distribution of all discovered motifs of...
Ngày tải lên: 14/08/2014, 16:21
the identification and characterization of proteins required for endocytosis in the budding yeast saccharomyces cerevisiae
... intracellular organelles, and into and out of the cell via the plasma membrane (reviewed in (Mellman and Warren 2000)) As the tools and techniques of biology evolved, so did the study of membrane trafficking ... fields of biochemistry and genetics continued to contribute to our understanding of how proteins and lipids are sorted and trafficked between myriad intracellular locales, advances in electron and ... successful experience Many of the faculty here at Johns Hopkins have been an immense help in guiding this work and my graduate and professional career Trina Schroer and Doug Koshland have played critical...
Ngày tải lên: 14/11/2014, 06:20
Identification and characterization of novel anticoagulants from bungarus fasciatus venom
... a meta-analysis. Lancet, 2000. 355 (9219): p. 1936-42. 156 150 . 151 . 152 . 153 . 154 . 155 . 156 . 157 . 158 . 159 . 160. 161. 162. 163. 164. 1 65. 166. 167. 168. Schulman, S., Advantages and limitations ... 1 95- 208. Koh, C.Y. and R.M. Kini, Molecular diversity of anticoagulants from haematophagous animals. Thromb Haemost, 2009. 102(3): p. 437 -53 . 149 47. 48. 49. 50 . 51 . 52 . 53 . 54 . 55 . 56 . ... 19 95. 86(8): p. 30 35- 42. Tan, A.K. and D.L. Eaton, Activation and characterization of procarboxypeptidase B from human plasma. Biochemistry, 19 95. 34(17): p. 58 11-6. Bajzar, L., R. Manuel, and...
Ngày tải lên: 09/09/2015, 11:08
Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides
... ***************** ************************ ***** -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 -53 4 43D7 43D8 43D2 CCGCTTTATAATGCTTTATAATCCTCTCTAAGTGGGTTTACAGAGTCAGCCTCTGGCCCCCAACAATTTGTGTCCTCCTTCCTT ... ***************** **** ************ ****** - 952 -949 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 952 - 953 - 952 - 952 - 952 - 952 - 952 43D7 43D8 43D2 CAAAGCAAACATTGCACCCCATACCAAATTATTGTATTATTTGTATTGTCTCTATTAGCGTGCCTCCAGGAATAGGGACGTGGC ... Materials and Methods 42 iii Reagents and kits; Collection of venom and venom gland; RNA isolation and cDNA synthesis; Cloning of ds cDNA; Isolation of plasmids and verification of clones;...
Ngày tải lên: 11/09/2015, 10:02
Stochastic optimal control and performance analysis of wireless ad hoc networks
... Optimization simultaneously ệ ẵẵ è ì ì ẵẵ ểềỉệ Use Stability Properties: Foster-Lyapunov, Geometric Drift Conditions Other Contributions: Decentralized Model-free Algorithm, Handle Partial Observability ... ỉểệ ễệ ì ềỉ ệ ề ì ìì ẵ ìẹẹ ệ ị ì ễỉ ệ Wireless Queueing Model for time-varying channel & topology Assumption: Channel State & Topology State Processes as Irreducible Aperiodic Markov Chain Wireless ... Value Iteration Foster-Lyapunov Provisioning Algorithm Contribution: Simultaneous Optimization, Stability, & Derivation of Bounds ệ ì ẵ ậẹẹ ệí ể ỉ ề ế ì ểệ ệệ é ề ẵ é ệ ể ềì ểệ ệ é ìì ế ...
Ngày tải lên: 14/09/2015, 12:46
The Flagellum Unspun - The Collapse of “Irreducible
... rejoinder Rhetoric and Public Affairs 1: 57 1–8 Doolittle, R F 1993 The evolution of vertebrate blood coagulation: A case of yin and yang Thrombosis and Heamostasis 70: 24–8 Doolittle, R F., and D F Feng ... threw up their hands and declared defeat for evolution, however, these researchers decided to the hard scientific work of analyzing the components of the cycle and seeing if any of them might have ... bright and innovative world of life that we have come to know through science Rather, it is a brittle and unchanging landscape, frozen in form and unable to adapt except at the whims of its designer...
Ngày tải lên: 01/11/2013, 08:20
Đề tài " Unique decomposition of tensor products of irreducible representations of simple algebraic groups " pot
... induction on the rank of g, by the fact that any simple Lie algebra of rank l, has a simple subalgebra of rank l − We analyze the restriction of the numerator of the Weyl character formula of g to the ... Weyl groups of the root system and the dual root system, given by α → α∗ and sα =t sα∗ the transpose of sα∗ We identify the two actions of the Weyl group (7) Denote by P ⊂ h∗ the lattice of integral ... on the number of components n and on the rank l of g We assume that the lemma has been proved for all simple Lie algebras of rank less than the rank of g We use the character expansion given by...
Ngày tải lên: 14/03/2014, 22:20