i think of a number worksheet ks2

think of a number

think of a number

Ngày tải lên: 27/10/2014, 17:35

96 375 0
Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

Đề tài " The number of extensions of a number field with fixed degree and bounded discriminant " docx

... Belolipetsky, Counting maximal arithmetic subgroups, preprint; available on arXiV as math.GR/0501198. [2] M. Bhargava, The density of discriminants of quartic rings and fields, Ann. of Math. 162 (2005), ... commands InvariantRing, PrimaryInvariants, and SecondaryInvariants in Magma.) One checks that R = R/f 1 R is an integral domain. Let S be the subring of R generated by f 2 , ,f 6 and g 2 , and let ... S n -invariants in the coordinate ring of (A n ) r EXTENSIONS OF A NUMBER FIELD 731 for all i ≤ m. It follows that all archimedean absolute values of γ i for i ≤ m are bounded by a constant multiple...

Ngày tải lên: 06/03/2014, 08:21

20 480 0
Providing detailed guidelines for implementation of a number of articles of the law on enterprise

Providing detailed guidelines for implementation of a number of articles of the law on enterprise

... owned capital 11 Article 18 Implementation of a capital contribution in, and rights and obligations related to capital contribution in a multiple member limited liability company 11 Article ... 3. Individual family household businesses. 4. Other organizations and individuals involved in the establi shment, managerial organization and operation, reorganization and dissolution of ... occupational-professional association to which the State delegates authority to issue practising certificates, to individuals with the professional qualifications and experience required for a certain...

Ngày tải lên: 27/03/2014, 10:15

28 631 0
current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

current situation of outsourcing development, a number of favorable factors promoting this industry as well as analysis of outsourcing activities FPT Software.doc

... CONTENTS Acknowledgements i Abstract ii List of Abbreviations iii List of Charts and Tables iv INTRODUCTION 1 I. Rationale 1 II. The significance of the study 2 III. Aims of the study 2 IV. Research ... i) What is software outsourcing, its advantages and disadvantages? ii) What is current situation of software outsourcing in Vietnam and which potentials it possesses? iii) What is FPT Software ... is positioned to participate fully in this market. At present, despite the rapid increase in both quality and quantities, the total value of this market is still relatively small in comparison...

Ngày tải lên: 27/10/2012, 16:41

79 613 6
Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

Some aspects of American culture and society in the twentieth and twenty-first centuries through a number of selected short literary works

... in particular and with our American friends in general. II.2.2. Racial discrimination Racial discrimination is as old as American history since the first black African slaves came to America over ... and farming origin supported by developed industry. Within the American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native ... such as fast pace of life, individualism, informality, modernity although their practice of these criteria varies in terms of degree. II.1.2. Literature II.1.2.1. Definitions Before having a discussion...

Ngày tải lên: 07/11/2012, 15:01

49 787 1
A Student Grammar of Spanish - Number

A Student Grammar of Spanish - Number

... amigos recibir la carta al d´ a siguiente Caminar (M)/andar hasta Correos No manejar un carro (M)/conducir un coche (Yo) entrar en la cocina y abrir la ventana Regresar a casa Escribir una carta ... de la monta˜na querer ense˜nar leer, desear invitar cenar, necesitar leer escribir, mandar llamar al plomero (M)/fontanero, aconsejar escribir, decidir mandar apagar iii Planeas ir de vacaciones. ... estad´ıstica statistics *la gente people *la malla tights *el pantal´on pants, trousers el pijama / la piyama (M) pajamas *la pinza pincers la t´actica tactics *la tropa troops Thewords asterisked...

Ngày tải lên: 01/11/2013, 06:20

14 573 1
Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

Tài liệu Báo cáo khóa học: TbPDE1, a novel class I phosphodiesterase of Trypanosoma brucei pdf

... TbPDE2 family. Outside of the catalytic domain, sequence similarity decrea- ses, within 10–40 amino acids at the N-terminal side of the domain, and within 15 amino acids at its C-terminal side. Expression ... C-terminal catalytic domain shares about 30% amino acid identity, including all functionally important residues, with the catalytic domains of human PDEs. A fragment of TbPDE1 containing the catalytic domaincouldbeexpressedinactiveforminEscherichia ... new family within this class. The amino acid sequence of its catalytic domain is approximately equidis- tant from those of all mammalian class I PDEs, the class I PDEs dunce of D. melanogaster,regAofD....

Ngày tải lên: 19/02/2014, 12:20

11 568 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... Section, University of California, San Diego, California, USA The ESSS protein is a recently identified subunit of mam- malian mitochondrial complex I. It is a relatively small integral membrane ... omplex II. Sources of other antibodies were as follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia ... assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) Prasanth Potluri, Nagendra Yadava and Immo E. Scheffler Division of Biology, Molecular Biology...

Ngày tải lên: 19/02/2014, 16:20

9 623 0
Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

Tài liệu Báo cáo khoa học: Experimental proof for a signal peptidase I like activity in Mycoplasma pneumoniae, but absence of a gene encoding a conserved bacterial type I SPase pdf

... the asparagine in position 26 was labeled within the intact protein at its a- amino group and represents the amino terminal amino acid of P40. The efficiency of this reaction was quite high, as ... mollicutes differ significantly from E. coli and Gram-positive bacteria [36], a signal peptide of 70 amino acids is not in agreement with this multi- variate data analysis. Therefore, the simplest ... substrate specificity, despite the substantial sequence similarities as indicated by six distinct regions with conserved amino acids [26]. For instance, LepB from Escherichia coli is 323 amino acids long and...

Ngày tải lên: 19/02/2014, 18:20

9 564 1
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... I Kentaro Shiraki 1 , Shigemi Norioka 2 , Shaoliang Li 2 , Kiyonobu Yokota 3 and Fumio Sakiyama 2, * 1 School of Materials Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan; 2 Institute ... protease I (API) has a unique region of aromatic ring stacking with Trp169–His210 in close proxi- mity to the catalytic triad. This paper reveals the electrostatic role of aromatic stacking in ... this unique aromatic stacking as a possible molecular mechanism in enzyme catalysis. Electrostatic interaction between Asp113 and His210 Histidine is one of the most functional amino acids among the...

Ngày tải lên: 21/02/2014, 03:20

7 607 0
Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces significant structural changes doc

... synthetic a- domain of murine MT-1. Fig. S2. Averaged positive-ion mode ESI mass spectra acquired from the synthetic b-domain of murine MT-1. This material is available as part of the online article from ... similarity. This could indi- cate that each domain adapts to host the additional copper (I) ions by opening up and rearranging its N- and C-terminal parts, minimizing the structural perturbation ... stoichiometries higher than five. Taken together, the initial additions of Cu (I) to each domain caused the disappearance of a large set of NOESY cross-peaks and the parallel appearance of another...

Ngày tải lên: 07/03/2014, 09:20

14 486 0
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot

... two-hybrid assays. (A) Yeast one hybrid assay showing that SmNR1 contains an autonomous transactivation function in A ⁄ B domain. Individual AH109 yeast colonies obtained from an initial transformation ... DNA and drive transcription in a mammalian cell reporter gene assay in in vivo results. Experimental procedures Parasites The NMRI strain of S. mansoni was maintained in snails (Biomphalaria ... splice site of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding...

Ngày tải lên: 07/03/2014, 11:20

16 548 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT 1300 CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTA AAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_1:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 900 CLAP_2:ATTCTCCTGGCATTAAAGATGGAATGGAGGGAACCACGATGCAAGGAAAGAGTCTCATATTTTCAATCAAAGATGGTGAGGTTATAATCAACAGCAAGAC 832 S P G I...

Ngày tải lên: 07/03/2014, 16:20

12 772 0
Cách sử dụng (Something) is down to (a number of something) pdf

Cách sử dụng (Something) is down to (a number of something) pdf

... me, Claire, and Maria - Hiện giờ chỉ còn t i, Claire và Maria. Lưu ý rằng khi sử dụng “down to” thường kèm “now”, ở đâu đó trong câu. V i b i viết Daily English Speaking Lesson này, ... half a bag of rice” = “chúng t i giờ chỉ còn n a bao gạo”. Thông thường bạn n i về số lượng sự vật/ đồ vật bị giảm, nhưng bạn cũng có thể liệt kê như: Now it’s down to just me, Claire, and ... ty c a bạn v a gặp ph i chút rắc r i. Phần lớn nhân viên trong bộ phận c a bạn đều bị sa th i. Và giờ chỉ có bạn, sếp c a bạn và 1 nhân viên n a. Bạn n i chuyện v i bạn c a mình về tình huống...

Ngày tải lên: 10/03/2014, 11:20

6 702 2
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... Stella 3 , Pierpaolo Aimola 4 , Donatella Barra 1 and Maria Luisa Mangoni 1 1 Istituto Pasteur-Fondazione Cenci Bolognetti, Dipartimento di Scienze Biochimiche, Azienda Ospedaliera S. Andrea, Universita ` La ... action; peptide–membrane interaction; proteomics Correspondence M. L. Mangoni, Unita ` di Diagnostica Molecolare Avanzata, II Facolta ` di Medicina e Chirurgia, Azienda Ospedaliera S. Andrea, via di Grottarossa, ... Vergata, Rome, Italy 4 Dipartimento di Biologia di Base ed Applicata, Universita ` de L’Aquila, Italy Keywords frog skin antimicrobial peptides; Gram-negative bacteria; mode of action; peptide–membrane...

Ngày tải lên: 16/03/2014, 00:20

18 495 0
Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx

Báo cáo khoa học: Trans-splicing of a mutated glycosylasparaginase mRNA sequence by a group I ribozyme deficient in hydrolysis pptx

... incubation at trans-splicing and RPA hybridization conditions. Below; quantitation of RPA of trans-spliced GA mRNA generatedbyDiGIR2AGUandDiGIR2DP9.2 AGU. Comparative quantitative data were collected ... RNA 1, undigested probe; RNA 2, trans-spliced GA mRNA; RNA 3, major GA band; RNA 4, major DiGIR2 AGU and DiGIR2DP9.2 AGU band. Additional bands result from degradation of RNA during incubation ... vitro transcription, splicing reactions and RT-PCR analysis PrecursorRNAsforcis-splicing analyses were transcribed from T7 promoters off BamHI-linearized pDiGIR2, pDiGIR2 AGU and pDiGIR2DP9.2 AGU plasmids. [ 35 S]CTP[aS]...

Ngày tải lên: 23/03/2014, 13:20

7 309 0
w