... losing information The increasing acceptance of standard formats for images and formatted text helps But some of the standards, such as SGML (Standardized General Markup Language) for text, are so ... Information Management and Systems He is a past president of the American Society for Information Science and a fellow of the American Association for the Advancement of Science He leads the Architectures ... crawler program humans may derive the metadata, which dards that would facilitate automated Another drawback of automated in- can then be attached to a Web page for indexing As a result, documents...
Ngày tải lên: 12/05/2014, 15:21
... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited...
Ngày tải lên: 03/06/2014, 00:59
how to write a problem statement for a paper
... your problem statement/abstract and revise as necessary Examples of Problem Statements MoJo: A Distance Metric for Software Clustering The software clustering problem has attracted much attention ... probabilistic latent variable modeling to automatically discover and quantify user “tasks” and task-level patterns from users’ navigation data, as well as from Web site's content and structure data ... data Based on this framework, we will propose a novel personalization approach, based on the maximum entropy principle, which allows for a seamless integration of contentbased and usage-based task-level...
Ngày tải lên: 22/03/2018, 00:25
Tài liệu Báo cáo khoa học: Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human transcobalamin and intrinsic factor pdf
... detecting chip (Fig 6) All the above facts mean that the intestinal uptake of analogues can be quite feasible In this regard we plan to examine a group of analogues concerning details of their binding ... Preparation of the unsaturated apo-form of IF was although modified Thus, the Cbl-saturated holo-IF (1 mgỈmL)1) was dialysed against 20 volumes of m urea (30 °C) instead of m GdnHCl The incubation ... ẳ DA352 ỵ DA361 ị IF0 DAmax ỵ DAmax Þ 352 361 where, e.g., DA352 corresponds to change of absorbance at wavelength 352 nm in the reaction sample after incubation time t; DAmax ¼ jACNCbl À AH2...
Ngày tải lên: 19/02/2014, 05:20
NATIONAL REPORT OF MALAYSIA ON THE FORMULATION OF A TRANSBOUNDARY DIAGNOSTIC ANALYSIS AND PRELIMINARY FRAMEWORK OF A STRATEGIC ACTION PROGRAMME FOR THE BAY OF BENGAL potx
... Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories The multiracial population of Malaysia ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... include: Friends of the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society,...
Ngày tải lên: 06/03/2014, 15:21
How to do a Debt Sustainability Analysis for Low-Income Countries pdf
... they are generally characterized by a grace period, a long maturity period and a back-loaded repayment profile A repayment profile is back-loaded if repayments increase as a loan matures For terms ... historical averages and standard deviations are calculated, if warranted, go to lines 58-63 in the sheet “Baseline” and adjust formulas accordingly Calculation of NPV of Debt Calculating the NPV of PPG ... historical averages as the default If the historical data in the template is provided for less then ten years, the historical average will be calculated on the basis of the historical data available...
Ngày tải lên: 15/03/2014, 14:20
Development of a DTPA soil test for zinc, iron, manganese, and cropper
Ngày tải lên: 15/03/2014, 23:56
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt
... Fukuda M, Chuang TD, Chavez JA, Lienhard GE & McGraw TE (2007) Rab10, a target of the AS160 Rab GAP, is required for insulinstimulated translocation of GLUT4 to the adipocyte plasma membrane Cell ... GLUT4 translocation, has a functional Rab GTPase-activating protein domain Biochem J 391, 87–93 Larance M, Ramm G, Stockli J, van Dam EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, ... Okada T, Kawano Y, Sakakibara T, Hazeki O & Ui M (1994) Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in rat adipocytes Studies with a...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Identification of a novel binding site for calmodulin in ammodytoxin A, a neurotoxic group IIA phospholipase A2 docx
... CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC GGAATTCGCgGCcGCCtTGTCACACTCACAAATCCGATTCTC GGGCAAGCTTGCgGCcGCAATCTGCTTTCGAcAGAATCTGAAcACATAttcgAAAAAGTATATGC GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG ... 2a+ 2b+ 2– 3+wt 3+YIRN 3– TAATACGACTCACTATAGGGAGACCACAACGGTTTCC GGGCaagcTTCCCCGTCTCCtCCAGGATCATCtTCCCG GGGCAAgcttgCTaTTcCCTCCTACTCCTcTTACGGATGCTACTGCGGCtgGGGGGG GACTGCAaCCCCAAAtCGGACAG CAAATACaAgCGGGtGAACGGGGCTATCGTCTGTGaAAAAGGC ... GGGCAAGCTTGCgGCcGCAATCTGCTTCCGAcAGAATCTGAAcACATACAgCTATATATATAGG GGAATTCTGCAGTTAGCATTTgagCTCtccCTTGCACAAgAAGTCCGG Ó FEBS 2003 3020 P Prijatelj et al (Eur J Biochem 270) Vista, CA), digested with BamHI/HindIII (fragment 1, 60...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing 39...
Ngày tải lên: 23/03/2014, 14:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... objective categories are potentially important for many text processing applications, such as information extraction and information retrieval, where the evidential status of information is important ... Kappa values, and raises the average agreement among the judges to a Kappa value of over 0.87 for the sentences that can be tagged with certainty Using only simple features, the classifier achieves ... of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic Computational Linguistics, 22(2):249-254 W Chafe 1986 Evidentiality...
Ngày tải lên: 23/03/2014, 19:20
Making sense of a complex world Accounting for royalty arrangements – issues for media companies pptx
... payments 20 Accounting for royalties payable – Recognition and valuation of assets and liabilities 23 Accounting for royalties payable – Stepped royalties 24 Accounting for royalties payable – Contingent ... an upfront payment for future royalties Royalties earned on the book’s sales are offset against the advance and only once the book generates more royalties than the value of the advance are additional ... advance a financial and monetary liability?” 12 MIAG Issue: Accounting for royalties receivable Advance payments In many media industries, particularly publishing, royalties are paid in advance...
Ngày tải lên: 29/03/2014, 20:20
Báo cáo khoa học: Identification of a preferred substrate peptide for transglutaminase 3 and detection of in situ activity in skin and hair follicles pdf
... [25,26] Although several studies have focused on the localization, structural analysis and activation mechanism of TGase zymogen, not much information is available about the substrate specificity and ... methods and analyzed with a microscope, BZ-8100 (Keyence, Osaka, Japan) Acknowledgements We greatly appreciate Dr Masatoshi Maki and Dr Hideki Shibata in our laboratory for providing valuable suggestions ... principle, because cadaverine is an amine substrate known to react with any active TGase Although aberrant TGase activity has been reported in several skin diseases, as a consequence of genetic mutation...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo Y học: Development of a selective photoactivatable antagonist for corticotropin-releasing factor receptor, type 2 (CRF2) potx
... difference was not statistically significant The photoactivatable antisauvagine-30 analog was shown to be as potent as its parent peptide when stimulating cAMP accumulation alone or suppressing agonist-induced ... may discriminate between the size and charge of the N terminal dipeptide fragment of antisauvagine-30 analogs However, the photoactivatable antisauvagine-30 analog did not cross-link to membrane ... L .A. , Rivier, J.E & Vale, W.W (1999) Comparison of an agonist, urocortin, and an antagonist, astressin, as radioligands for characterization of corticotropin-releasing factor receptors J Pharmacol...
Ngày tải lên: 31/03/2014, 08:20
báo cáo hóa học: " Validation of a core outcome measure for palliative care in Africa: the APCA African Palliative Outcome Scale" pptx
... HIV management in sub-Saharan Africa: How much palliative care is needed? AIDS Care 2007, 19(10):1304-1306 13 Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality -of- Life ... Clinical Epidemiology 2007, 60(12):1315 28 Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality -of- Life Index among patients with advanced AIDS in urban Kampala, ... Johannesburg, Gauteng, South Africa 4African Palliative Care Association, PO Box 72518, Kampala, Uganda 5Hospice Palliative Care Association of South Africa, PO Box 38785, Pinelands 7430, Cape...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf
... mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment of the ... case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion of the stem ... M, Jaecques S, Perre G Van der: Followup of implant performance using RSA In Proceedings of the International seminar Prediction and evaluation of total hip replacement performance: can we plan...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Biomechanical testing of a polymer-based biomaterial for the restoration of spinal stability after nucleotomy" pptx
... significant at p < 0.05 ROM and NZ are Results Nucleotomy was performed by a standard microsurgical interlaminar approach Intradiscal implantation of the PGA-HA nucleus-implant as well as sealing of ... was approached from laterally, we performed a microsurgical dorsal approach, commonly utilized for lumbar disc herniations With this standard approach, lateral parts of the annulus and even lateral ... 0.209) However, analyzing all samples individually revealed a trend toward reduction of the NZ in every single sample with implantation of the PGA-HA nucleus-implant Statistical Analysis For statistical...
Ngày tải lên: 20/06/2014, 04:20