hocking from the dictionary of a

... Motivated by the fact that the fractional Laplacean generates a wider choice of the interpolation curves than the Laplacean or bi-Laplacean, we propose a new non-local partial differential equation ... contains a wide damaged area in the shape of a rectangle in the middle of the image For three different parameters l the proposed method was tested against the MATLAB inpainting function called ... make the practical computation faster and more efficient For a mathematical analysis of the fourth order models we refer to [35] Several years later the investigation of fractional models started

Ngày tải lên: 27/09/2020, 15:17

... (accessed January 2013) Magagula, C and A Ngwenya 2004 A comparative analysis of the academic performance of distance and on-campus learners http://tojde.anadolu.edu.tr/tojde16/articles/ magagula.htm ... (accessed 12 April 2010) Hall, I and D Hall 2004 Evaluation and social research: Introducing small-scale practice Hampshire: Palgrave Macmillan Hardy, M and A Bryman 2004 Handbook of data analysis ... Pretoria, Pretoria Aluko, F R 2009 The impact of an Advanced Certificate in Education (ACE) programme on the professional practice of graduates International Review of Research in Open and Distance

Ngày tải lên: 11/10/2022, 10:54

... them in their capacity as a local education authority are exercised with a view to safeguarding and promoting the welfare of children The governing body of a maintained school shall make arrangements ... a place at the school and has a sibling already attending 2.1.5 FAP –Fair Access Protocol If a child’s name appears with FAP – this means that negotiations have taken place with the head teacher/deputy ... already been offered and the parent needs to advise the Admissions Team if they want the alternative school It could also be that the parent has been offered a higher preference and the team are

Ngày tải lên: 23/10/2022, 04:21

... changing world of contemporary art The ability to possess the artwork of others in a way that is transformative, creative and unique allows for the renaissance of traditional artwork through the ... topic of artistic appropriation draws from many sources and commentary in order to assist in painting a picture of what it means to portray an aesthetically stimulating image as a means of self-expression ... ideas of critics and art professionals and their approach to art and curating as it gained momentum in postmodern America Appropriation counters the traditional notion of art history that, “The

Ngày tải lên: 27/10/2022, 18:38

... includes average basic pay for each military grade, basic allowance for housing, basic allowance for subsistence, and federal tax advantage accruing to the aforementioned allowances because ... relate them to budgetary outlays by DoD and other federal agencies We also analyze the fairly crude estimates of the cost of a military person-year that result from the application... ... because they are not subject... modern casualty treatment options have changed the ratio and cost of deaths and disabilities drastically 12 The Cost of a Military Person-Year have

Ngày tải lên: 17/02/2014, 23:20

... (R) CTCACCACAGACGATWTCC PLA5G2 (F) CGGTAAGCCCATAACGCCCA PLA3G2 (R) CAGGCCAGGATTTGCAGCC PLA3G4 (R) CATAAACAYGAGCCAGTTGCC ARTF a (F) GAGTGGATGCACAGTCGTTG ARTR a (R) GAAACGGAGGTAGTGACACAT AtxBF b (F) ... GCCTGCTCGAATTCGGGATG AtxBrc b (R) CTCCTTCTTGCACAAAAAGTG AtxACF c (F) CTGCTCGAATTCGGGATG AtxACrc c (R) GTCYGGGTAATTCCTATATA AmlF d (F) GTGATCGAATTTGGGAAGATGATCCA Amlrc d (R) CCCTTGCATTTAAACCTCAGGTACAC a Specific ... (F) CCCTATAGTGAGTCGTATTA T7 Promoter (R) CAGGAAACAGCTATGAC PLA5G (F) CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG PLA3G (R) CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG PLA5G1 (F) AGGAYTCTCTGGATAGTGG PLA3G1 (R) CTCACCACAGACGATWTCC PLA5G2

Ngày tải lên: 17/03/2014, 03:20

... Modeling the three-dimensional structure of H+-ATPase of Neurospora crassa Proposal for a proton pathway from the analysis of internal cavities Olivier Radresa1, Koji Ogata2, Shoshana Wodak2, Jean-Marie ... aspartate (Asp378 in PMA1_NEUCR), several cavities are also seen at the same position in ATC1_RABIT (data not shown) Aside from mutations directed against a small stretch of amino acids adjacent to the ... (1994) Computer analysis of bacterial haloacid dehalogenases defines a large superfamily of hydrolases with diverse specificity Application of an iterative approach to database search J Mol Biol

Ngày tải lên: 23/03/2014, 21:20

... this is the case, removal from the action of the ataxia telangiectasia mutated (ATM) ⁄ ataxia telangiectasia and RAD53 related (ATR) kinases at the site of DNA damage may decrease the kinase ⁄ ... phosphatases Abbreviations ATM, ataxia telangiectasia mutated; ATR, ataxia telangiectasia and RAD53 related; 4NQO, 4-nitroquinoline 1-oxide; FACS, fluorescent activated cell sorter; H2AX, histone 2AX; ... to these chemotherapeutic agents, ionizing radiation and chemical mutagens, activation of the DNA damage response pathways causes arrest of the cell cycle to allow time for cells to repair the

Ngày tải lên: 30/03/2014, 04:20

... interaction with their membranes. Materials and methods Materials All chemicals were of the purest analytical grade available. Proteases, aprotinin, lysozyme, and a-casein were from Sigma-Aldrich. ... the inhibitor of acrosin – the major protease of mammalian spermatozoa – from the crab-eating monkey, Macaca fascicularis (Table 1). Whereas many Kazal inhibitors have proline at P 2 , only twowerereportedtohaveprolineatP 1 [43,44]. ... pET-PSKP-1 as the template and primers 5¢- CTGCCAGGCTGCCCGAAAGATATT AACCCGGTGTGC-3¢ and 5¢-CGGGCA GCCTGGCAG TTCATATTTATAGCATTTCGG-3¢ (the mutated codons are underlined). The PCR product was cloned

Ngày tải lên: 30/03/2014, 13:20

... by the General Assembly of the State of Ohio._ _Acts of a Local Nature Passed by the General Assembly of the State of Ohio._ Pennsylvania _Laws of the General Assembly of the State of Pennsylvania._ ... formal declarations of the Bishop of London, the abrogation of the law that a Christian could not be held as a slave Then allowed access to the bondmen, the missionaries of the Church of England, ... Resolves Passed by the General Assembly of the State of Rhode Island and Providence Plantations._ South Carolina _Acts and Resolutions of the General Assembly of the State of South Carolina._ BREVARD,

Ngày tải lên: 31/03/2014, 18:20

... notes taken through- out for later verbatim transcription and analysis. Data management was facilitated using N6 computer software. All participants completed a demographic questionnaire and the ... School of Rural and Northern Health, Laurentian University, 935 Ramsey Lake Road, Sudbury, Ontario, P3E 2C6, Canada and 6 Division of Health Care and Outcomes Research and Arthritis and Community ... a con- stant comparative method of analysis whereby data col- lection and analysis occurred simultaneously. We used a deductive approach to analyze the validity check focus group data. We examined

Ngày tải lên: 18/06/2014, 19:20

... strands b and c are anti-parallel. The main differences between domains γ1 of AAG and abrin-a occurred in N-terminal. The N- terminal of the AAG A-chain is one residue shorter than that of the abrin-a ... chains, and one in CD-chains. An AAG molecule is a tetramer, consisting of AB (or CD) and symmetry-related A'B' (or C'D'). Structure of the AAG A(or C)-chain The AAG A(or C)-chain ... Page 5 of 13 Figure 1 Comparison of AAG with abrin-a (green) molecule. The α-carbon backbone of abrin-a AB-chains are superimposed on that of the AAG molecule using least-squares analysis. A

Ngày tải lên: 10/08/2014, 05:21

... Faculty of Medicine, University of Calgary, 3330 Hospital Drive NW, Calgary AB T2N 4N1, Canada Email: Adel Gabriel* - gabriel@ucalgary.ca; Claudio Violato - violato@ucalgary.ca * Corresponding author ... assessment Adel Gabriel*1 and Claudio Violato2 Address: 1University of Calgary and Calgary Health region, 2000 Pegasus Rd NE, Calgary AB T2E 8K7, Canada and 2Department Community Health Sciences, Faculty ... and admission to a psychiatric ward) were more often rated as harmful than helpful, and some nonstandard treatments (increased physical or social activity, relaxation and stress management, reading

Ngày tải lên: 11/08/2014, 17:20

... one vital fact she was not staring at a canvass The scene before her was real And she was a part of the reality She was standing on a vast, flat plain; a cream colored, synthetic surface much ... boats came the flash of fire and the roar of cannon A full-fledged battle was in progress The wanderer watched the desperate, determined fighting along the causeways and at the main gates of the ... glide above the residential and market areas toward the sister city, Tlatelolco, the wanderer realized that the parrot was still speaking " inspired stone carvings and murals gardens radiating...

Ngày tải lên: 06/11/2012, 17:33

... BAA British Airports Authority Operator of Heathrow and other UK airports BACAT Barge-aboard-catamaran Back haul (or load) An alternative term for return loading, a back load or return load A ... the business of the parent/holding company or any of its subsidiaries ATA American Trucking Association Virtual equivalent of our Road Haulage Association ATA carnet A Customs carnet (ie clearance ... minds a van is always a ‘Transit’, most curtain-sided vehicles and trailers are called ‘Tautliners’ although many of them are not of this make, and lorry-mounted cranes from a variety of manufacturers...

Ngày tải lên: 30/08/2013, 23:58

... prediction and the available transcriptome data, can be applied for the initial detection and isolation of NRPs [20] Furthermore, this approach substitutes the CAS assay-guided fractionation and enabled ... (Hartmann Analytic, Braunschweig, Germany) was added The supernatants were extracted with XAD16 resin after an additional days of growth The dried eluate was dissolved in 10% methanol and analyzed ... investigated On the basis of the analysis of the S erythraea genome, transcriptome and the structural characterization, an NRPS-dependent assembly of erythrochelin mediated by a tetramodular NRPS...

Ngày tải lên: 16/02/2014, 09:20