... array DCD 2, 4, 7, 3, 1, 2, 10, 11, 5, 13 Trang 4array DCD 10 Code: INCLUDE stm32l1xx_constants.s ; Load Constant Definitions INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, ... UpperCase- Chuyển thành chữ hoa Đề: Viết chương trình asm chuyển từ ký tự thường sang ký tự hoa Code: INCLUDE stm32l1xx_constants.s ; Load Constant Definitions INCLUDE stm32l1xx_tim_constants.s ... nghiemj phức và 0 với trường hợp còn lại Code: INCLUDE stm32l1xx_constants.s ; Load Constant Definitions INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA quadraticEquation, CODE, READONLY
Ngày tải lên: 17/01/2018, 21:45
... (Sách Embedded Systems with ARM Cortex-M Microcontrollers in Assembly Language and C (Third Edition) – Dr Yifeng Zhu ) Đại Học Bách Khoa Đà Nẵng BÀI TẬP CHƯƠNG 7 SÁCH (Có code đính kèm) 71_ChuyenSangChuHoa ... Trang 22INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA variance, CODE, READONLY Trang 23LDR r4, =n ; r4 = &n Trang 24INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, ... Trang 16cua hang thu i Trang 17check_i INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, READONLY ENTRY Trang 18;r0 = flag, r1 = num, r2 = i , r3 = i*i BNE loop Trang 19INCLUDE
Ngày tải lên: 17/01/2018, 23:29
Lập trình vi điều khiển STM32L152 bài tập chương 10 sách Embedded Systems with ARM CortexM Microcontrollers in Assembly Language and C (Third Edition – Dr Yifeng Zhu)
... PIN 7), CLK INCLUDE stm32l1xx_constants.s ; Load Constant Definitions INCLUDE stm32l1xx_tim_constants.s ; TIM Constants Trang 6IMPORT strcat AREA main, CODE, READONLY EXPORT main ; make main ... connected RESET ; - GREEN LED: connected to PB7 (GPIO Port B, PIN 7), CLK RCC_AHBENR_GPIOBEN ; - BLUE LED: connected to PB6 (GPIO Port B, PIN 6), CLK RCC_AHBENR_GPIOBEN Trang 9; - Linear touch ... (Sách Embedded Systems with ARM Cortex-M Microcontrollers in Assembly Language and C (Third Edition) – Dr Yifeng Zhu ) BÀI TẬP CHƯƠNG 10 (Có code đính kèm) 1 XoaKyTuTrongChuoi_C Call a C Program
Ngày tải lên: 18/01/2018, 11:03
Lập trình vi điều khiển chip STM32L152 bài tập chương 8 sách Embedded Systems with ARM CortexM Microcontrollers in Assembly Language and C (Third Edition – Dr Yifeng Zhu)
... du cua phep chia r1/r3 Trang 6Code: INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, READONLY Trang 8B thành chữ E… Code: Trang 9INCLUDE stm32l1xx_tim_constants.s ; TIM Constants ... main, CODE, READONLY Trang 10Code: INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, READONLY linker ENTRY Trang 12INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, ... b CMP r2, #0 ; c == 0 countinue while BEQ skip skip LSR r0, #1 stop1 Trang 18INCLUDE stm32l1xx_tim_constants.s ; TIM Constants AREA main, CODE, READONLY Trang 20Code: INCLUDE stm32l1xx_tim_constants.s
Ngày tải lên: 18/01/2018, 14:54
Genome-wide identification of mitogen-activated protein kinase gene family in Gossypium raimondii and the function of their corresponding orthologs in tetraploid cultivated cotton
... phosphorylating various downstream targets [8-10] According to amino acid sequencing, MAPK contains 11 domains (I–XI) that are necessary for the catalytic function of serine/threonine protein kinase, and ... group B, six in group C and 10 in group D GrMAPKs in sub-group A, B, C possess a Thy-Glu-Tyr (TEY) and a short C-terminus containing a common docking (CD) domain consisting of the sequence [LHY]Dxx[DE]EpxC, ... GrMAPKs are located in the activation loop between kinase subdomain VII and VIII All GrMAPK protein sequences contain four types of special subdomains, including the active site, ATP binding site,
Ngày tải lên: 27/05/2020, 00:40
polycomb complexes prc1 and their function in hematopoiesis
... surfaces can impair ubiquitin ligase activity Characteristically, canonical PRC1 complexes contain RING1-PCGF2 and RING1-PCGF4 E3 ligases, whereas the remaining E3 ligases are constituents of non-canonical ... Polycomb CBX proteins is a conserved sequence, in the proximity of the chromodomain, that contacts the histone acetyltransferase (HAT) domain of CRE-binding protein (CBP) Such an interaction interferes ... other in isolated PRC1 complexes Ub-like motifs of PCGF proteins, instead, associate with specific PRC1 components For example, PCGF2/MEL18 and PCGF4/BMI1 interact with PHC proteins, whereas PCGF1/NSPC1
Ngày tải lên: 04/12/2022, 15:55
A study of some linguistic features of expressions describing the villains in kiều story and their english translational equivalents
... Chapter 1, INTRODUCTION Chapter 2, LITERATURE REVIEW and THEORETICAL BACKGROUND Chapter 3, METHODS AND PROCEDURES Chapter 4, FINDINGS AND DISCUSSION Chapter 5, CONCLUSIONS AND IMPLICATION\ CHAPTER ... characteristics Lexicologically, the classification is conducted on some of typical and common features in the work such as Sino — Vietnamese, proverbs and idioms, dialectal words and classic references ... vocabulary choice such as Sino-Vietnamese words; Chinese and Vietnamese idioms and proverbs and lots of classical references, reduplicative, dialectal words which were used to describe the characters,
Ngày tải lên: 26/11/2013, 13:21
Báo cáo y học: " Alterations in hippocampal serotonergic and INSR function in streptozotocin induced diabetic rats exposed to stress: neuroprotective role of pyridoxine and Aegle marmelose" doc
... distribution of insulin receptors in the brain and the presence of insulin-dependent glucose transporters suggest that brain insu-lin participate in several cognitive functions, including learning and memory ... memory In control rats, hippocampus dependent learning is correlated with a decrease in extracellular glucose, and intrahippocampal injection of glucose improves performance [3] Learning-induced changes ... [41] In animal models of diabetes, impairments of spatial learning occur in association with distinct changes in hippocampal synaptic plasticity due to defects in insulin action in the brain [42]
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
... ACGTTGGATGTGCTGTATCTATAGCCCTCC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG rev ACGTTGGATGAATCCCCGCAGACCATGACAC rev ACGTTGGATGACCATGACACCTTCCTGCTG rev ACGTTGGATGCCACTTCCTCTGCACAAATC rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGCCAGCACATCTTTTCACTCC rev ACGTTGGATGGGAACATCACAGGAAATGAC rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG rev ACGTTGGATGTATGGTTCGACTGAGTCCAC Trang 6while FEV1 was increased in carriers ... polymorphisms in individuals with asthma and concomitant BHR, we investigated this spe-cific phenotype in the case control population Again, no SNP reached statistical significance in the association
Ngày tải lên: 12/08/2014, 16:20
automatic letter-colour associations in non-synaesthetes and their relation to grapheme-colour synaesthesia
... & Marini, 1998), which comprises three main stages According to Zeki’s model, wavelength information is initially processed in V1 and V2, after which colour constancy occurs in “colour area” ... This indicates that the perception of colour contrast (including colour constancy) may begin as early as V1, rather than in extrastriate visual cortex as predicted in the classically accepted ... (169 msec vs 106 msec, classical modified-Stroop task) and photism naming (60 msec vs 34 msec, the same task but grapheme-ignoring print colours and instead naming induced colour concurrents)
Ngày tải lên: 22/12/2014, 21:17
A genre investigation of higher degree research proposals in english language and english literature
... “benefits”, “competence claim”, “importance claim”, and “compliance claim” Connor and Mauranen found that some of these claims, such as the “competence claim” and “compliance claim” are specific to ... for Academic Purposes (EAP) practitioners in their learning and teaching practices Although the research will be specific to a local discourse community, the findings may have wider relevance for ... research MOVE 2 ESTABLISHING A NICHE Step 1A Counter-claiming Step 1B Indicating a gap Step 1C Question-raising Step 1D Continuing a tradition MOVE 3 OCCUPYING THE NICHE Step 1A Outlining
Ngày tải lên: 16/09/2015, 12:42
DSpace at VNU: CHARACTERIZATION OF DOMAINS IN C-n BY THEIR NONCOMPACT AUTOMORPHISM GROUPS
... 135–160 NONCOMPACT AUTOMORPHISM GROUPS DO DUC THAI and NINH VAN THU Abstract In this paper, the characterization of domains in C n by their compact automorphism groups are given. non-§1 IntroductionLet ... ξ0 = 0 and the rank of Levi form at ξ0 is exactly n− 2 Let ρ be a smooth defining function for Ω After a linear change of coordinates, we can find coordinate functions z1, , zn defined on ... number δ First, we construct the coodinates Trang 7about z′ introduced by S Cho (see also in [9]) These coodinates will beused to define the polydisc.Let us take the coordinate functions z1, ,
Ngày tải lên: 12/12/2017, 07:48
DSpace at VNU: Effects of climate change on geo-disasters in coastal zones and their adaptation
... Variations of rain intensity and frequency increase in areas of high liquefaction risk In practice, climate change simultaneously alters the sea level rise and rain intensity and frequency Accordingly,Fig ... humans and social property (direct economic loss) Heavy rains also cause landslides and economic loss through the effects of slope disasters (indirect economic loss) Predicting these economic losses ... rise and the increase in rain intensity and frequency caused by climate change will expand the areas facing high liquefaction risk 5 Risk of slope disaster 5.1 Background Climate change exacerbates
Ngày tải lên: 16/12/2017, 04:42
DSpace at VNU: Quantum chemical investigation of epoxide and ether groups in graphene oxide and their vibrational spectra
... favorable structure is an approximately planar one, with the Z C–C s-bond remaining intact Symmetrical ‘buckling’ of this structure about its C2axis (forming a C–O–C moiety, but breaking the Z C–C s-bond) ... by a CREST (Core Research for Evolutional Science and Technology) grant in the Area of High Performance Computing for Multiscale and Multiphysics Phenomena from the Japanese Science and Technology ... and GO today stems from their outstanding physicochemical properties,1,2 which make their application in nanoscale electronic and optical devices a potential reality Structural models of GO have
Ngày tải lên: 16/12/2017, 15:55
Diabetes MILES Youth–Australia: Methods and sample characteristics of a national survey of the psychological aspects of living with type 1 diabetes in Australian youth and their parents
... socioeconomic background Discussion: The online survey format was a successful and economical approach for engaging young people with type 1 diabetes and their parents This rich quantitative and ... appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made The Creative Commons Public Domain Dedication waiver ... “different” from their peers All these changes can contribute to diabetes self-care being neglected [11], such as not checking blood glucose or skipping insulin doses, contributing further to sub-optimal
Ngày tải lên: 10/01/2020, 13:32
Occurrence of extended–spectrum Beta-lactamases (ESBLS) producing enterobacteria in animal products and their environment
... Publishing Co.) Georgia, U.S.A 290 Fadel, H.M and Ismail, J 2009 Prevalence and significance of staphylococcus aureus and Enterobacteriaceae species in selected dairy products and handlers Int J ... sec 94°C, 30 sec Elongation 72°C, 40 sec 72°C, 40 sec 72°C, 45 sec Final extension 72°C, 5 min 72°C, 5 min 72°C, 5 min Trang 7Table.3 Isolation rate of Enterobacteria in various animal products ... complex (I.L.F.C.), Teaching veterinary clinical complex (T.V.C.C.) of College of Veterinary Science & Animal Husbandry, animal farms nearby Kumarganj Samples were collected aseptically and transported
Ngày tải lên: 14/01/2020, 13:47
Aerobic bacteria in Crèche environment and their antibiotic sensitivity
... 6Table.2 Occurrence of Bacterial isolate in each Crèche ISOLATE CR1 CR2 CR3 CR4 Total Creches Lac fermenti Occurre nce % Occur rence Occur rence % Occurren ce Occur rence % Occurre nce Occurre ... distinct colonies and also distinctive cultural characteristics and sub-cultured to obtain a pure culture Microscopic characterization was done by Gram staining followed by biochemical tests including ... nce % Occurre nce Total % Occurre nce Total Occurre nce (%) KEYS: CR1- Crèche 1, CR2- Crèche 2, CR3- Crèche 3, CR4- Crèche 4 Trang 7Table.3 Antimicrobial susceptibility patterns to antibiotics
Ngày tải lên: 14/01/2020, 19:08
“Charge Storage in WO3 polymorphs and their application as supercapacitor
... Science and Engineering and Optoelectronics Convergence Research Center, Chonnam National University, Gwangju 61186, South Korea 3- Department of Electrical and Computer Engineering, Old Dominion ... application of SCs is more feasible in low energy consumption devices or using them in tandem with the battery SCs are classified into two types, electrochemical double layer capacitors (EDLC) and ... phases Keywords: Supercapacitor, Tungsten oxide, Crystal phases, Surface controlled capacitance, charge storage, pseudocapacitive 1 Introduction Recently, owing to factors such as greenhouse gas
Ngày tải lên: 17/04/2020, 07:01
Báo cáo khoa học: BRCA1 16 years later: risk-associated BRCA1 mutations and their functional implications pptx
... BRCA1 may contribute to cancer by promoting genomic instability and accumulation of cancer-causing mutations [6], a process further accelerated by p53 mutation, a common characteristic of BRCA1 ... including p21, and by physically interact- ing with cell cycle regulators (reviewed in [9]). BRCA1 can also recruit chromatin modifying proteins, such as histone acetyltransferases and histone deacetylases, and ... failed G2-M checkpoint [42], whereas breast cancer cells expressing only the 5382InsC mutant maintained an intact G2-M checkpoint [21]. Fan et al. [39] reported that in DU145 prostate cancer cells...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Roles of matrix metalloproteinases in cancer progression and their pharmacological targeting pdf
... tetracyclines, lacking antibiotic activities, may inhibit MMPs by binding to metal ions such as zinc and calcium. This family of inhibitors, including metastat (COL-3), minocycline and doxycycline, cause ... angiostatin, tumstatin, endostatin and endorepellin. MMPs also modulate the cell–cell and cell–ECM interactions by processing E-cadherin and integrins, respectively, affecting both cell phenotype ... proteolytic activity like MMPs, although their main roles focus on ectodomain shedding and nonpro- teolytic functions, such as binding to adhesion mole- cules, integrins and interacting with phosphorylation sites...
Ngày tải lên: 15/03/2014, 00:20