học xong chương 6 chúng ta có thể

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

Báo cáo khoa học: The starch-binding capacity of the noncatalytic SBD2 region and the interaction between the N- and C-terminal domains are involved in the modulation of the activity of starch synthase III fromArabidopsis thaliana pdf

... W366A D1 D2 D3 CD CD-D123Y394A D1 D2 D3 CD CD-D123W366AY394A Y394A x x x W366A Y394A 1025 22 316 344 405 1025 576 575 22 290 456 316 344 405 535 495 CD + D123W366A CD + D123Y394A CD + D123W366AY394A ... of mutated proteins for ADPGlc. Isoform S0.5 (m M ) nH Vmax (unitsÆmg)1) CD+D123W366A 0.91 ± 0.14 2.1 ± 0.4 0.86 ± 0.22 CD+D123Y394A 0.76 ± 0.10 3.3 ± 0.3 0.96 ± 0.26 CD+D123W366AY394A 0.69 ± ... AAACATATGCTATATTACAATAAAA GG; 2.2up, AAACATATGTTATCTATCGTTGTAAAGC; 2.3up, AAACATATGCTTGTTCCTCAAAAACTTCC; 3.3rv, AAACTCGAGTTTTCCATTCAAAACCGTG Construction of site directed mutants The mutated proteins D123W366A,

Ngày tải lên: 22/03/2014, 21:20

13 457 0
The Education Of The Negro Prior To 1861 - A History of the Education of the Colored People of the United States from the Beginning of Slavery to the Civil War pdf

The Education Of The Negro Prior To 1861 - A History of the Education of the Colored People of the United States from the Beginning of Slavery to the Civil War pdf

... vol v., p 63.] [Footnote 2: Code Noir, p 107.] [Footnote 3: _Jesuit Relations_, vol v., p 62.] After 1716, when Jesuits were taking over slaves in larger numbers, and especially after 1726, when ... 246;Dalcho, _An Historical Account of the Protestant Episcopal Church in South Carolina_, pp 156, 157, 164.] [Footnote 2: Ibid., pp 157 and 164.] In 1764 the Charleston school was closed for reasons ... of the United States_, vol i., p 6; Bancroft, _History of the United States_,vol ii., p 401.] [Footnote 5: Locke, _Anti-slavery_, p 32.] [Footnote 6: _Ibid._, p 30.] The inevitable result of

Ngày tải lên: 31/03/2014, 18:20

191 506 0
COMMUNICATION FROM THE COMMISSION TO THE EUROPEAN PARLIAMENT, THE COUNCIL, THE EUROPEAN ECONOMIC ANDSOCIAL COMMITTEE AND THE COMMITTEE OF THE REGIONS

COMMUNICATION FROM THE COMMISSION TO THE EUROPEAN PARLIAMENT, THE COUNCIL, THE EUROPEAN ECONOMIC ANDSOCIAL COMMITTEE AND THE COMMITTEE OF THE REGIONS

... cooperation with stakeholders from other interested Baltic Searegion states 5 Facilitating implementation of the EUSBSR in cooperation with the Member States (i.e.national contact points, line ... horizontal action leader(s) inimplementation of the tasks referred Trang 16and recommendations to the policy discussions and policy development in the Baltic Searegion.4 Establishing and maintaining ... by tackling the main challenges or by seising key opportunities Typically, one Member State coordinates each priority area or horizontalaction, and they work on implementation in close contact

Ngày tải lên: 11/09/2020, 14:39

192 34 0
unit 5 the media unit 5 the media lesson 1 getting started listen and read i the aims 1 objectives helps students know some vocabulary about the media by the end of the lesson students will be abl

unit 5 the media unit 5 the media lesson 1 getting started listen and read i the aims 1 objectives helps students know some vocabulary about the media by the end of the lesson students will be abl

... exercise (Complete the sentences on the card) - Checks and gives the right answer 06’ 06’ 06’ 06’ 06’ - Listen - Copy down - Work individually - Listen and remember - Do the exercise ... details - They have a chance to listen and speak with their friends 2) Teaching points: Tag question; listen for details 3) Preparation: Teacher’s: Lesson plan, English book, cassette, tape, ... poster (table P45) Work in pairs to ask and answer questions about television programs these people like or dislike use tag question Exercise 3: - Asks students to work in pairs, look at the table,

Ngày tải lên: 09/04/2021, 22:22

16 8 0
week 1st m«n tiõng anh líp 3 the date of planning the date of teaching week 1st lesson 1 2 prepare for the beginning of the academic year i aims and objectives to help the students to know about the

week 1st m«n tiõng anh líp 3 the date of planning the date of teaching week 1st lesson 1 2 prepare for the beginning of the academic year i aims and objectives to help the students to know about the

... practise all the words in the two periods 5 and 6 - Take the teacher cards of objects and ask for Ps to say the name of objects T: take the card of “pen” - Take the teacher cards and ask for Ps to say ... other Ps remark) Activity3: Practice - Take the teacher cards of objects and ask for Ps to say the name of objects T: take the card of “ book” - Take the teacher cards and ask for Ps to say ... - Take the teacher cards + Ask: T: What’s this? + Answer: T: It’s a/ an - Take the teacher cards and ask for Ps to practise in group - Ask for Ps to practise in pair - Correct the mistakes

Ngày tải lên: 12/04/2021, 01:40

17 16 0
slide 1 describe the weather in the seasons it’s in the it’s warm in the spring it’s hot in the summer it’s cold in the winter it’s cool in the fall 1 2 3 4 period 79 lesson 2 a3 – the weather and the

slide 1 describe the weather in the seasons it’s in the it’s warm in the spring it’s hot in the summer it’s cold in the winter it’s cool in the fall 1 2 3 4 period 79 lesson 2 a3 – the weather and the

... seasons Lesso2 : A3 – The weather and seasons 1 Listen and repeat : Listen and repeat to the tape Trang 6Lesso2 : A3 – The weather and seasonsNam Liªn What weather do you like? I like hot weather ... picturesUnit 13 : Activities and the seasons Lesso2 : A3 – The weather and seasons Trang 10Free talk: Let s talk about the weather you like! ’s in the Lesso2 : A3 – The weather and seasons What’s

Ngày tải lên: 12/04/2021, 15:17

14 13 0
unit 7 my neighborhood check the old lesson 1 retell the new structure that you studied in the first lesson give the form 2 show the usage of the present perfect give some examples unit 7 con

unit 7 my neighborhood check the old lesson 1 retell the new structure that you studied in the first lesson give the form 2 show the usage of the present perfect give some examples unit 7 con

... 2: Speak + Listen Trang 4A SpeakTrang 5Mrs Kim Trang 6I/ Vocabulary1 Parcel (n) 2 Airmail (n) 3 Surface mail (n) 4 Item (n) 5 Charge (n/ v) 6 Weigh (n) weight (v) Trang 71, Practice the dialogueClerk: ... 3, Has Na ever been to a soccer match before? -> No, She hasn’t 4, What time does the match start? -> At 4p.m Trang 14V/ Homework- Learn vocabulary by heart - Write 2 similar dialogues in

Ngày tải lên: 17/04/2021, 23:50

15 20 0
slide 1 golden gate bridge great wall of china the taj mahal wonders of the world monday 21st march 2010 match the names of the famous world landmarks to the correct pictures the pyramids sydney oper

slide 1 golden gate bridge great wall of china the taj mahal wonders of the world monday 21st march 2010 match the names of the famous world landmarks to the correct pictures the pyramids sydney oper

... beautiful beach in the world. Trang 15 Nha TrangTrang 161. It’s a famous mountain.Trang 17Mau Son MountainTrang 181. It’s one of World Heritage 3. It’s a cave. Trang 19Phong Nha CaveTrang 20-Practice ... pictures.Trang 9The PyramidsSydney Opera House Stonehenge The Statue of Jesu Roman-Closseum Ha Long Bay Trang 10Stonehenge The Pyramids The Statue of JesuHa Long Bay Sydney Opera House Colosseum Trang ... girls started to play.Nga thought of a (2) _and she gave the others a (3) by saying that it wasn’t in (4) Nhi found out the place was in (5) _ Hoa thought it was the (6) Gate

Ngày tải lên: 20/04/2021, 02:46

21 6 0
LANGUAGE ASSESSMENT evaluative essay analyze the targets of all the questions in the exam paper, the tasks in all the skills assessment, and the question writing techniques

LANGUAGE ASSESSMENT evaluative essay analyze the targets of all the questions in the exam paper, the tasks in all the skills assessment, and the question writing techniques

... forms of gap-filling (Task 1, Q1-5; Task 2, Q1-2) and sequencing tasks (Task 2, Q3-6) The former’s task items are designed with little modifications Trang 8from the tapescript while the latter are ... the listening and writing tasks show substantial room for improvement For the listening tasks, the writing of gap-filling items in Q1-2 of task 2 underrepresents the target skill of listening ... not included Trang 6in the curriculum, and does not serve any meaningful assessment target in the entirety of the task.Writing task 2 also touches on a topic that is not the target of writing

Ngày tải lên: 11/03/2022, 16:20

16 23 0
Individual research project The status of the equity market before the COVID-19 crisis. The impact of Coronavirus pandemic and the rebound on the equity market

Individual research project The status of the equity market before the COVID-19 crisis. The impact of Coronavirus pandemic and the rebound on the equity market

... <https://www.fxempire.com/forecasts/article/the-importance-of-stock-markets-663262> Aran Ali, 2020, “The World’s 10 Largest Equity markets”, Visual Capitalist, viewed 12 January 2021 <https://www.visualcapitalist.com/the-worlds-10-largest-stock-markets/> ... <https://www.visualcapitalist.com/the-worlds-10-largest-stock-markets/> Statista, 2020, “Distribution of countries with largest equity markets worldwide as of January 2020, by share of total world equity market value”, Statista, viewed 12 January ... low” , Financial Times, viewed 13 January 2021, <https://www.ft.com/content/1d7b267a-6d1e-4012-b4f5-095a63eac626> Sean M Jones, Patrick J Rogers & Darina A Koleva, 2020, “COVID-19: NYSE

Ngày tải lên: 09/05/2022, 20:33

15 8 0
The light of buddhism shines again in the south the reasons for the woodblock printing plate engraving of buddhist scriptures in northern vietnam when exposed to the japanese canons in the early 20th century

The light of buddhism shines again in the south the reasons for the woodblock printing plate engraving of buddhist scriptures in northern vietnam when exposed to the japanese canons in the early 20th century

... Mahasaṃnipata Sutra 大方等大集經, the Mahayana Prajnaparamita Sutra 大 乘 摩 訶 般 若 經 , each with 30 scrolls, first engraved the printing plates for the Mahayana Prajnaparamita, then for the Mahasaṃnipata Sutra).”11 ... 佛祖統紀) from Tripitaka Japonais, 至 IX, 60 v o (Volume 9th century) has counted the number of books of the Zhi 至box in the Japanese canon) Its catalogue shows to be the same as the catalogue ofHongjao ... fairly stable Meanwhile, the shortage of supply inthe North posed a need for exposure to a larger source at that time.The Madhyagma Agama 中阿含經, Chinese version, kept at Viên Giác pagoda (Huế) Stamp:

Ngày tải lên: 31/07/2022, 12:19

27 6 0
Sự du nhập hoa tulip vào châu âu và hội chứng hoa tulip ở hà lan thế kỷ XVII the introduction of the tulip to europe and the tulip mania in the netherlands in the 17th century”, tạp chí khoa học xã hội và nhân vă

Sự du nhập hoa tulip vào châu âu và hội chứng hoa tulip ở hà lan thế kỷ XVII the introduction of the tulip to europe and the tulip mania in the netherlands in the 17th century”, tạp chí khoa học xã hội và nhân vă

... 12 năm 1634 đến tháng 12 năm 1635, sau đó tăng thêm 50% trong sáu tháng từ tháng 12 năm 1635 đến tháng 5 năm 1636 Tiếp đó, nó lại tăng gấp ba lần nữa từ tháng 6 cùng năm đến tháng 1 năm 1637 Do ... dạng Vào năm 1600, khoảng hơn 100 giống, đến thập niên 1630 khoảng 1.000 giống (trong đó 500 giống gốc từ Hà Lan) Đến giữa thế kỷ XVIII tăng lên 2.500 và ngày nay tới 5.000 giống ... người ta thể mua được một ngôi nhà đắt đỏ với một khu vườn nhỏ và cả nhà xe ngựa cạnh một kênh đào ở Amsterdam (Potter 2013: 166) Bởi khi đó, một căn hộ hạng nhất tại các thành thị của Hà Lan

Ngày tải lên: 15/10/2022, 16:18

13 19 0
Assess the compatibility between the regulations of vietnamese laws and the 1982 convention on the law of the sea on defining the baselines for measuring the breadth of the territorial sea

Assess the compatibility between the regulations of vietnamese laws and the 1982 convention on the law of the sea on defining the baselines for measuring the breadth of the territorial sea

... 9Part 1: The continental coastal baseline consists of 10 straight sections of 11 basis points with a total length of 846 nautical miles, starting from point A0 " point 61 adjacent to 0 of ... Convention also stipulates: When determining certain baselines, the coastal state may take into account the distinct economic benefits of that region whose importance has been demonstrated through long-term ... practical 6 Clause 6, Article 7 of the 1982 Law of the Sea Convention. Trang 7circumstances in which the state can draw a straight baseline, which is that "the coasts are truly unstable due

Ngày tải lên: 30/11/2022, 16:54

14 7 0
(TIỂU LUẬN) individual research project the status of the equity market before the COVID 19 crisis  the impact of coronavirus pandemic and the rebound on the equity market

(TIỂU LUẬN) individual research project the status of the equity market before the COVID 19 crisis the impact of coronavirus pandemic and the rebound on the equity market

... <https://www.fxempire.com/forecasts/article/the-importance-of-stock-markets-663262> Aran Ali, 2020, “The World’s 10 Largest Equity markets”, Visual Capitalist, viewed 12 January 2021 <https://www.visualcapitalist.com/the-worlds-10-largest-stock-markets/> ... <https://www.visualcapitalist.com/the-worlds-10-largest-stock-markets/> Statista, 2020, “Distribution of countries with largest equity markets worldwide as of January 2020, by share of total world equity market value”, Statista, viewed 12 January ... low” , Financial Times, viewed 13 January 2021, <https://www.ft.com/content/1d7b267a-6d1e-4012-b4f5-095a63eac626> Sean M Jones, Patrick J Rogers & Darina A Koleva, 2020, “COVID-19: NYSE

Ngày tải lên: 02/12/2022, 18:28

15 6 0
(TIỂU LUẬN) LANGUAGE ASSESSMENT evaluative essay analyze the targets of all the questions in the exam paper, the tasks in all the skills assessment, and the question writing techniques

(TIỂU LUẬN) LANGUAGE ASSESSMENT evaluative essay analyze the targets of all the questions in the exam paper, the tasks in all the skills assessment, and the question writing techniques

... Trang 101 ListeningThe listening tasks are constructed in the forms of gap-filling (Task 1, Q1-5; Task 2, Q1-2)and sequencing tasks (Task 2, Q3-6) The former’s task items are designed with little ... characteristics of the target situations As for the writing tasks, while the sentencecompletion task matches the target of assessing vocabulary, the paragraph writing task fails toclearly communicate ... writing, and speaking. The table below demonstrates the assessment targets of the test according to the sixcomponents mentioned above Table 1 Assessment targets Performance Target Genres Topics Conditions

Ngày tải lên: 11/12/2022, 04:38

22 9 0
Nghiên cứuNghiên cứu biện pháp nâng cao thể lực cho nam sinh viên chuyên ngành bóng đá ngành giáo dục thể chất Trường Đại học Thể dục Thể thao Bắc Ninh. biện pháp nâng cao thể lực cho nam sinh viên chuyên ngành bóng đá ngành gdtc trường đại học thể dục th

Nghiên cứuNghiên cứu biện pháp nâng cao thể lực cho nam sinh viên chuyên ngành bóng đá ngành giáo dục thể chất Trường Đại học Thể dục Thể thao Bắc Ninh. biện pháp nâng cao thể lực cho nam sinh viên chuyên ngành bóng đá ngành gdtc trường đại học thể dục th

... 1TRƯỜNG ĐẠI HỌC THỂ DỤC THỂ THAO BẮC NINHNGUYỄN TUẤN ANH NGHIÊN CỨU BIỆN PHÁP NÂNG CAO THỂ LỰC CHO NAM SINH VIÊN CHUYÊN NGÀNH BÓNG ĐÁ NGÀNH GIÁO DỤC THỂ CHẤT TRƯỜNG ĐẠI HỌC THỂ DỤC THỂ THAO BẮC ... SV phải cókhả năng làm việc độc lập, phương pháp làm việc khoa học, sáng tạo, cónăng lực vận dụng lý thuyết trong công tác chuyên môn, cũng như khảnăng tự họchọc tập suốt đời.Chương ... SVbóng đá còn phải học các môn học thực hành không chuyên ngành khác, cụthể là: Năm học thứ nhất - HK 1: điền kinh, thể dục (60 tiết), đá cầu (30 tiết); HK 2 - điền kinh thể dục (60 tiết), cờ vua

Ngày tải lên: 09/05/2023, 21:40

223 8 0
Tiểu luận - TÂM LÝ THỂ DỤC THỂ THAO - đề tài - Đặc điểm của giáo dục thể chất và đặc điểm giảng dạy bài tập thể chất, cũng như nâng cao hiệu quả giáo dục thể chất. Được anh chị hiểu và giải quyết như thế nào khi là giáo viên TDTT

Tiểu luận - TÂM LÝ THỂ DỤC THỂ THAO - đề tài - Đặc điểm của giáo dục thể chất và đặc điểm giảng dạy bài tập thể chất, cũng như nâng cao hiệu quả giáo dục thể chất. Được anh chị hiểu và giải quyết như thế nào khi là giáo viên TDTT

... Trang 1TÂM LÝ THỂ DỤC THỂ THAO Trang 2CHUYÊN ĐỀ 1:Đặc điểm của giáo dục thể chất và đặc điểm giảng dạy bài tập thể chất, cũng như nâng cao hiệu quả giáo dục thể chất Được anh chị hiểu ... hoạt động giáo dục thể chất và giảng dạy bài tập thể chất:  Đặc điểm của hoạt động giáo dục thể chất  Đặc điểm giảng dạy bài tập thể chất  Các yếu tố nâng cao hiệu quả giáo dục thể chất Trang ... dục thể chất Trang 7 Hoạt động giáo dục thể chất đòi hỏi ở người tập ý chí, nghị lực và thể chất tương đối cao nhưng chưa tới mức tối đa. Trang 8 Trong hệ thống giáo dục thì giáo dục thể

Ngày tải lên: 17/11/2024, 06:44

14 4 0
Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

Tài liệu The Role of BCG Vaccine in the Prevention and Control of Tuberculosis in the United States: A Joint Statement by the Advisory Council for the Elimination of Tuberculosis and the Advisory Committee on Immunization Practices docx

... United States (MMWR 1988;37:663–4, 669–75) Since the previousrecommendations were published, the number of TB cases have increasedamong adults and children, and outbreaks of multidrug-resistant ... 94% According to 1993 sional data for the United States, 1,670 deaths were attributed to TB, representing amortality rate of 0.6 deaths per 100,000 population The mortality rate for 1953 was12.4 ... Epidemiology of TB in the United States 3 TB Prevention and Control in the United States 4 BCG Vaccines 5 Vaccine Efficacy 5 Vaccine Safety 7 Tuberculin Skin Testing and Interpretation of Results After

Ngày tải lên: 15/02/2014, 13:20

27 1,3K 3
w