... and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3 Acknowledgement ... (Duchefa, Haarlem, The Netherlands) Tissues were cleared in ethanol and visualized with a stereomicroscope (Leica MZ16FA) RNA isolation and real-time quantitative RT-PCR analysis RNA was isolated ... PTI1-4 (At2g47060) was cloned in the pBD-GAL4 cam (Stratagene, La Jolla, CA, USA) and were each used as bait to screen an Arabidopsis pACT2 cDNA library [36] The yeast strain PJ69- 4A [37] containing...
Ngày tải lên: 14/02/2014, 19:20
... carcinoma cells Oncogene 20, 2499–2513 Kanda N, Seno H, Konda Y, Marusawa H, Kanai M, Nakajima T, Kawashima T, Nanakin A, Sawabu T, Uenoyama Y et al (2004) STAT3 is constitutively activated and supports ... RHN(CH2)6CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3 NHR (hpST3dODN), which was derived from the seruminducible element of the human c-fos promoter, and RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH2)3NHR ... they are treated with IFN-c, we can tentatively conclude that it interacts with the activated forms of STAT3 and STAT1 The actions of STAT3 and STAT1 are highly entangled, they also have antagonistic...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: "Generating Usable Formats for Metadata and Annotations in a Large Meeting Corpus" pptx
... (db loader.sql) Create and populate the annotation database Adapt the XSLT stylesheets as needed for various annotations and/ or table formats 4 Metadata: Generation of Explicit Files and Conversion ... names or analyse folders Moreover, the advantage of creating IMDI files is that the metadata is compliant with a widely used standard accompanied by freely available tools such as the metadata ... information The main goal of the present work is to facilitate the use of the AMI Corpus metadata and annotations as part of the larger objective of automating the generation of annotation and metadata...
Ngày tải lên: 08/03/2014, 02:21
Báo cáo Y học: Na+/K+-ATPase as a signal transducer Zijian Xie and Amir Askari docx
... the past few years [22–26] have clearly indicated that the same nontoxic concentrations of ouabain that cause partial inhibition of Na+/K+-ATPase and an increase in cardiac contractility, also ... but also to the activation of p42/44 MAPK (also called ERK1/2) through the Ras/Raf/ MAPK kinase/MAPK cascade (where Raf is a MAPK kinase kinase and MEK is a MAPK kinase) [29,30] However, the activation ... ligand for the extracellular domain of Na+/K+-ATPase is K+ Lowering of [K+]o has been shown to act in a manner similar to ouabain and activate the proximal segments of the signaling pathways...
Ngày tải lên: 24/03/2014, 00:21
báo cáo khoa học: "A signal amplification assay for HSV type 1 viral DNA detection using nanoparticles and direct acoustic profiling" ppsx
... provides an easy and useful measure for assay quality and has been a widely accepted standard Z-factor reflects both the assay signal dynamic range and the data variation associated with the signal ... coupled mass of the particle, ii) the proximal contact area between the particle and the sensor surface and iii) the available capture area on the particle and binding dynamics to this capture area ... increase the available surface capture area, then enhanced the hybridisation signal with gold nanoparticles derivatised with thiolated complimentary DNA [14] In this case, the hybridisation assay...
Ngày tải lên: 11/08/2014, 00:22
Matrix pencil method as a signal processing technique performance and application on power systems signals
... of signal processing in these areas The application, advantages and disadvantages of relevant signal processing techniques are also discussed in this chapter • Chapter describes the mathematical ... SVD, matrix inverse method and eigenvalue method These methods are available in the base package of LabVIEW and hence, no additional software packages have been employed 16 Chapter Performance ... Statistical Analysis of MPM Feature Extraction Performance of MPM for Power System Signals In power systems, we often have to measure and process voltage and current signals A typical instantaneous...
Ngày tải lên: 01/10/2015, 17:27
USING a NONLINEAR COUPLER TO SORT a SEQUENCE OF WEAK AND STRONG PULSES
... NONLINEAR COUPLER In the laser operation, a series of closed to Gaussian pulses with arbitrary amplitude may appear Mathematically, the dependence of laser intensity on time can be approximately ... results, we can conclude that the nonlinear coupler can be used not only as switching and performing logic operations, but also as sorting a sequence of weak and strong pulses, separating them ... chosen arbitary, the series of output pulses from output port-1 and output port-2 are simulated and illustrated in Fig 198 HO QUANG QUY, VU NGOC SAU, NGUYEN THI THANH TAM AND CHU VAN BIEN Fig a) ...
Ngày tải lên: 31/10/2015, 10:44
Báo cáo y học: "A review of anatomical and mechanical factors affecting vertebral body integrit
... end plate The disc facilitates intersegmental movement while maintaining alignment of the vertebral column and has a primary role in attenuating and dispersing axial load With aging, the water ... in part attributable to its large surface to volume ratio This ratio is approximately four times greater than that observed in cortical bone [72] With age and menopause, the trabecular bone mass ... 40-50% of trabecular mass by 90 years of age [58] This results in a decline in the loadbearing capacity of the vertebral body For example, load bearing capacity in a lumbar vertebra can decrease from...
Ngày tải lên: 03/11/2012, 09:49
Editorial Stanley Publishing A To Zed or A To Zee - Grammar and Usage
... intensifier A TO ZED, A TO ZEE US GB That was a real nice meal That was a really nice meal He drives real fast In informal American English, real is often used before adjectives and adverbs where ... differences we have mentioned are small and easily understandable in context, even if they sound amusing or quaint, as shan't and ought in the US, or as gotten and in back of in GB Many usages, it is ... a bath now and then? Position of adverbs Certain adverbs, known as midposition adverbs (e.g sometimes, always, never, often, definitely, certainly], are usually placed after auxiliary verbs and...
Ngày tải lên: 25/10/2013, 15:20
Hacking from a network: SYN flood and TCP Sequence number prediction attacks
... encapsulate part of the message in an ICMP packet and return it TCP Header - SYN Flag Frame Header Data Data IP Datagram Header Data TCP Header Source Destination Sequence Port Port No ACK No HDR Length ... so will disable a service until the attacker decides to: go away and SYN no more IDIC - SANS GIAC LevelTwo ©2000, 2001 This was an elegant attack, for a small number of packets an attacker could ... address are that it is valid, routable to, and not active or reachable Many sites have a large number of unused IP addresses and not employ network address translation They tend to be the stars...
Ngày tải lên: 26/10/2013, 23:15
FTTX Architecture Creating a Cost Effective Plug-and-Play FTTX Architecture
... installation and maintenance can be accomplished quickly and easily Additionally, easy access at the MST facilitates maintenance and troubleshooting by allowing technicians to simply unplug a connector ... instructions and materials for cleaning hardened connectors and adapters To clean the connector and adapter, the dust caps and plugs are removed to expose the inner optical components The adapter can then ... cable stubs and hardened adapters on the exterior surface MSTs are designed for outdoor applications and can be installed in hand-holes and pedestals, mounted on utility poles or overhead cable,...
Ngày tải lên: 27/10/2013, 00:15
A Grammar for Reading and Writing
... sentences a great chapter in American life came to a close and a great new chapter began To test this analysis, try shifting the modifier: A great chapter in American life came to a close, and a great ... than maybe by CAPITALIZING and punctuation! Speakers can also introduce a “pregnant pause” that draws attention to last word uttered and introduces anticipation of the next idea Writers can achieve ... sentence these chunks normally fall, and What meaning can we attach to a particular chunks that is, to a particular grammatical construction occurring in a particular position in a sentence? Complete...
Ngày tải lên: 04/11/2013, 11:15
Digital Signal Cross-Connect and Digital Signal Interconnect Products
... equipment and allow efficient and organized cable routing Panels and chassis are selected and installed separately for system customization and flexible growth Bays are also available fully loaded ... cabling used Traditionally, DSX rear cross-connect bays are spaced 10 inches apart and front cross-connect bays are spaced inches apart to allow for cable and jumper routing Notice that a rack ... for bay alarm indicators and AC light switches • maintenance bay is typically designated as every third or fourth bay within a DSX lineup A In addition to DSX chassis, auxiliary or maintenance...
Ngày tải lên: 04/11/2013, 13:15
A Simple SOAP Client and Server
... other data store to retain the value of particular variables with a particular session—again, using a simple name and value pairing When the value of a particular variable is needed, the application ... 22 } 23 21 FEATURE Database Abstraction in PHP Creole, Metabase, PDO, PEAR::DB, PEAR::MDB and PEAR::MDB2 Each of these packages has specific features and drawbacks that set it apart from the ... use a certain permission container and one or more different auth containers That means, you can have your users' data scattered among many data containers and have the LiveUser class try each...
Ngày tải lên: 04/11/2013, 14:15
A Primer on Check and ATM Cards
... their accounts on a regular basis, debit card holders can maintain the most up-to-date available balances what if you lose your ATM receipt? All check card transactions will appear as deductions ... can be used at merchant locations wherever the card logo is displayed what does it cost? Banks determine the fees for each card and/ or transaction how you keep track of your check card transactions? ... cash disadvantages of using debit cards: • • Although accepted at over 10.5 million locations around the world, debit cards cannot be used in all situations (making cash and checks necessary in...
Ngày tải lên: 04/11/2013, 20:15
Introduction to RF Equipment and System Design
... the International Civil Aviation Organization (ICAO) and applied by national bodies like the Federal Aviation Authority (FAA) in the United States Naturally, if 15 16 Available Parameters the ... CHAPTER Antennas and Associated Hardware 97 5.1 Antenna Selection Criteria 5.2 Some Antenna Types 5.2.1 Individual Antenna Elements 5.2.2 Antenna Arrays 5.2.3 Vehicle-Mounted Arrays 5.3 Antennas ... assumed 20 Available Parameters scenarios If we want to build a gun-laying radar, an approximate maximum distance to the potential target could be approximately 20 km A surveillance radar, on the...
Ngày tải lên: 05/11/2013, 12:15
A study on syntactic and pragmatic features of insertion sequence in english and vietnamese
... the tasks as follows: - Collecting and classifying data - Analyzing data - Making a contrastive analysis to find out the similarities and differences between the syntactic and pragmatic features ... subject And a positive declarative generally takes a negative tag-question whereas a negative declarative generally takes a positive tag-question, as follows: [7] I can’t be sure, can I? [8] And ... syntax and pragmatics in English and Vietnamese? What are the differences and similarities of insertion sequence in terms of syntax and pragmatics in English and Vietnamese? What are the implications...
Ngày tải lên: 26/11/2013, 13:16
A study on syntactic and pragmatic features of thank givings in english and vietnamese
... others assume that has taken during a particular Questionaires contain 10 situations for each language: English contact Face in a image of self delineated in terms of approval and Vietnamese They are ... methods to describe and analyze the syntactic and pragmatic features of thankgivings in English and Vietnamese The quantitative approach is also of syntactic and pragmatic features according to modern ... in and more great By means of communication, people employ ways of thank-givings; the affect of Social and Cultural behaviors in language to exchange and express ideas and purposes, they are also...
Ngày tải lên: 26/11/2013, 13:16
A study on syntactic and pragmatic features of asking and answering in english and vietnamese job interviews
... present, describe and analyze the syntactic and semantic features of EWGH and VWGT b To make a comparison and indicate the similarities and differences on linguistic features between EWGH and VWGT with ... research questions will be addressed a What are syntactic features of EWGH and VWGT? b What are semantic features of EWGH and VWGT? c What are the main similarities and differences between EWGH and ... in an Chapter 4: Findings and discussion attempt that the research may help Vietnamese and English learners Chapter 5: The conclusion and implications have a better understanding of syntactic and...
Ngày tải lên: 26/11/2013, 13:16
A study on english and vietnamese idioms relating to spiritual life
... anniversary was always an spiritual words are discussed and analyzed in main semantic fields 25 26 such as appearance, personality, human feelings, experience, belief, Last but not least, one main and ... cao có m t” are important and necessary occasion They are always ready to have taken as examples essential gatherings of members of family They also prepare a lot of Fifthly, through English and ... read a - An Investigation into Pragmatic and cultural aspects of variety of document; note to idioms, compare passages, and base on the context to translate them into their own language suitably...
Ngày tải lên: 26/11/2013, 13:18