... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock Step Insert the red and black leads into the proper jacks on the meter a The black probe ... tip of the red, positive lead on the positive side of a battery Put the tip of the black, negative, lead on the other end of a battery a Is any number showing up on the multimeter? _If not, make ... _ Name one important function of a multimeter _ If a voltage is negative when measuring a battery, what is wrong? 2-2 CCNA 1: Networking Basics v 3.0 - Lab 3.1.1...
Ngày tải lên: 21/12/2013, 19:15
... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high bandwidth-delay ... flows 10 Stability • Stability index of UDT and TCP – Stability: average standard deviation of throughout per unit time – 10 UDT flows and 10 TCP flows with different RTTs Stability Index 0.8 0.6...
Ngày tải lên: 15/01/2014, 15:59
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT ... vector was obtained from pJH2-SSTR2 by homologous recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢)...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... certainty ratings and 1, and and are combined Similar results are obtained when all ratings are treated as distinct 251 sets On each fold, one set is used for testing, and the other nine are used ... Bruce and J Wiebe to appear Recognizing subjectivity: A case study of manual tagging Natural Language Engineering J Carletta 1996 Assessing agreement on classification tasks: The kappa statistic ... editors, Advances in Knowledge Discovery and Data Mining AAAI Press/MIT Press J Cohen 1960 A coefficient of agreement for nominal scales Educational and Psychological Meas., 20:37-46 A P Dawid and A...
Ngày tải lên: 23/03/2014, 19:20
báo cáo hóa học:" Gender differences in health-related quality of life of adolescents with cystic fibrosis" ppt
... withdrawal; mental health – anxiety, depression and positive affect; self esteem – satisfaction with school and athletic ability, looks/appearance, ability to get along with others and family, and ... Interpretation of changes in health-related quality of life: the remarkable universality of half a standard deviation Med Care 2003, 41:582-92 Farivar SS, Liu H, Hays RD: Half standard deviation ... Caldwell DS, Stainbrook D, Hackshaw KV, Fox LC, Wilson K: Gender differences in pain, coping, and mood in individuals having osteoarthritic knee pain: a within-day analysis Pain 2004, 110:571-577...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Gender differences in health related quality of life of young heroin users" docx
... Avenida Monforte de Lemos 28029-Madrid, Spain 5Fundación Andaluza para la Atención e Incorporación Social (FADAIS) Avda de Hytasa, edificio Toledo II Plt., 3ª, Ofic Domingo-Salvany et al Health and ... and Australian samples of heroin, cocaine and amphetamine users Addiction 1995, 90:607-614 30 Gonzalez-Saiz F, Salvador-Carulla L: Estudio de fiabilidad y validez de la versión española de la ... and with worries and anxieties about drug use It satisfies a number of criteria indicating its suitability as a measure of dependence[29] It was applied to assess dependence severity (range 0,...
Ngày tải lên: 20/06/2014, 15:20
báo cáo khoa học:" Quality of life of children and their caregivers during an AOM episode: development and use of a telephone questionnaire" pps
... was calculated as the mean of the scores in the six domains The OM-6 also contains a visual analog scale of happy and sad faces allowing the caregiver to rate their child QOL on a 10-point scale ... Setting and study population In May-June 2008, a telephone survey was conducted in a stratified sample of households in all Canadian provinces by a contracted company using random-digit dialling ... development and used of a telephone questionnaire designed to measure the severity of AOM and its consequences on the QOL of the child and of the caregiver and its use in a country-wide survey in Canada...
Ngày tải lên: 12/08/2014, 01:21
A MANUAL OF PRONUNCIATION FOR PRACTICAL USE IN SCHOOLS AND FAMILIES CONTAINING A CAREFUL SELECTION pdf
... known, and the correction of such faults in adult life is a matter of considerable care and effort This manual has been prepared for practical use in the school-room and for the use of families and ... PREFACE Nothing so quickly or so certainly reveals the character of our culture and early associations as our speech The persistence of habits formed in youth, especially bad habits of pronunciation, ... the fact is indicated by a star opposite these words It is a source of much satisfaction to know that many words, asalbumen, address, coadjutor, divan, horizon, harass, idea, incisive, inquiry,...
Ngày tải lên: 22/03/2014, 16:22
báo cáo sinh học:" Burnout and use of HIV services among health care workers in Lusaka District, Zambia: a cross-sectional study" pot
... prevalence, related morbidity and mortality are responsible for health provider absenteeism and attrition In Zambia, mortality rates are high and before ART was available, death was a common cause ... Health Management Team) and Graham Samungole (Lusaka Urban District Health Management Team) for their assistance in study implementation and recruitment We thank Moffat Zulu and Martin Daka of CIDRZ ... comprise the vast majority of health care workers Participants were stratified according to clinic of employment and professional cadre, and then randomly selected Overall, 13 invitations were...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " Development and validation of a preference based measure derived from the Cambridge Pulmonary Hypertension Outcome Review (CAMPHOR) for use in cost utility analyses" doc
... social activities (I can join in activities with family and friends, I'm unable to join in activities with family and friends, I feel very isolated) and Travelling (Travelling distances is not a ... designed and managed the valuation survey, analysed and reported on the valuation data and contributed to the writing of the manuscript All authors read and approved the final manuscript Acknowledgements ... individuals into particular health states on the basis of their responses to the CAMPHOR For example, an individual who indicates that they can join in activities with family and friends, that travelling...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học: " Age and gender differences in seven tests of functional mobility" doc
... indicate the start and end of the m path and a m approach was allowed before reaching the start marker so that participants were walking at their normal pace within the timed path The participants ... near tandem balance tests are less similar to everyday tasks than tests such as the sit to stand and stair negotiation which are integral elements of activities of daily living Normative data ... Coordinated stability Near tandem balance Walking speed Sit to stand Alternate step Stair ascent Stair descent Figure Percentage of participants who performed each test adequately Percentage of participants...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo khoa học nông nghiệp " A PRELIMINARY EVALUATION OF ADOPTION AND IMPLEMENTATION OF BETTER MANAGEMENT PRACTICES IN THE CATFISH FARMING INDUSTRY IN THE MEKONG DELTA, VIETNAM " ppt
... data • Testing for diseases in seed, quality of feed and disease sample analysis during growout • Collation and reporting of all BMP monitoring and compliance data • Liaison and coordination with ... provinces with emphasis on An Giang and Can Tho Individual and group Deeper understanding (of each farmer’s reactions; more probing) and qualitative analysis Survey respondents Focus of study Qualitative ... farmer characteristics) This approach reduced the data into a more analytical and readable format and a new way of thinking about the data The new transcripts were then interrogated for patterns...
Ngày tải lên: 21/06/2014, 04:20
Báo cáo y học: "he combined effect of gender and age on post traumatic stress disorder: do men and women show differences in the lifespan distribution of the disorder" potx
... same age pattern for men and women and are only different in terms of an elevated level of scores among women and in the gender- related ranking of age groups In contrast, Ditlevsen and Elklit ... hold many life changing moments such as, getting married, starting a family, choosing a career, and so on Perhaps herein is a great part of the explanation Frequent changes and individual development ... size of the population by which each age group has reached a certain representative size All the data has been analysed by retrospective analysis and no contact has been made with any participants...
Ngày tải lên: 09/08/2014, 01:21
Báo cáo y học: "Gender differences in suicidal expressions and their determinants among young people in Cambodia, a post-conflict country" doc
... land is covered by landmines, a legacy of decades of war The per capita gross national product (GNP) is 293 USD and 37% of the population lives in absolute poverty, earning less than a dollar ... plans and attempts, in a sample of young men and women in Cambodia, a low-income post-conflict country in social transition We examined the associations between these suicidal expressions and ... based on a group discussion among psychologists and professionals working at the Center for Child and Adolescent Mental Health (CCAMH), Takhmau, Kandal province, Cambodia The “Attitudes Towards Suicide”...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: "Personal stigma and use of mental health services among people with depression in a general population in Finlan" ppt
... District Author details Vaasa Hospital District and National Institute for Health and Welfare, Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, FI- 65320, Finland 2Department of Psychology, ... Health and Welfare, Psychiatric Unit of Vaasa Central Hospital, Sarjakatu 2, Vaasa, FI65320, Finland Authors’ contributions All authors have read and approved the final manuscript EA conceived the ... University of Jyväskylä, P.O Box 35, FI40014, Finland 3South-Ostrobothnia Hospital District, Psychiatric Clinic of Lapua, Sairaalantie 9, FI-62100 Lapua, Finland 4National Institute for Health and...
Ngày tải lên: 11/08/2014, 15:22
Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"
... Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals In these hospitals, data were obtained for the years ... introduced an MET service using the first year of data as baseline and the second year as comparator Finally, an additional and similar analysis was performed for hospitals that had participated ... diagram of the Medical Emergency with intensive care units hospitals in Australian and New Zealand with intensive care units The diagram does not include hospitals participating in the Medical...
Ngày tải lên: 25/10/2012, 10:35
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods
... graduate Thermodynamics in the Department of Mechanical Engineering at UFRJ He is a member of the Brazilian Society of Mechanical Sciences and Engineering (ABCM) and of the American Institute of ... Valero A Exergy accounting: Capabilities and drawbacks Energy 2006, 31(1), 164-180 Giannantoni C., Lazzaretto A. , Macor A. , Mirandola A. , Stoppato A. , Tonon S., Ulgiati S Multicriteria approach ... steam and process hot water demands are also equality constraints [19] The inequality constraints are represented by the allowable ranges of variation of the decision variables, presented in Table...
Ngày tải lên: 05/09/2013, 16:30