göttingen a center of the quantum mechanics of molecules 1925 1930

Báo cáo Y học: The human b-globin locus control region A center of attraction potx

Báo cáo Y học: The human b-globin locus control region A center of attraction potx

... the HLH family of proteins and binds to DNA as a heterodimer usually composed of USF1 and USF2 USF has been implicated in the regulation of many genes and normally acts as a transcriptional activator ... the deacetylation and inactivation of the embryonic domain This idea is supported by the data of Forsberg et al [89] showing that the pattern of histone acetylation across the globin locus varies ... regulation of the human b-globin locus focuses on the ability of the LCR to act as a center of attraction for various regulatory activities found in the cellular milieu The LCR nucleates and perpetuates...

Ngày tải lên: 18/03/2014, 01:20

11 461 0
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf

... and 16,000 lemmas from both European and American variants of Portuguese They are aligned with the translationally equivalent concepts of the English Princeton WordNet and, transitively, of the ... with the corresponding values for its inflectional features of Gender and Number, that resulted from its morphological analysis; lemmata — the lemmata (singular and masculine forms when available) ... upon HMMs with the help of TnT (Brants, 2000) It was trained over a manually annotated corpus of approximately 208,000 words, and evaluated against an unseen portion with approximately 52,000 words...

Ngày tải lên: 17/03/2014, 02:20

4 305 0
Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

Báo cáo sinh học: " Molecular biodiversity of cassava begomoviruses in Tanzania: evolution of cassava geminiviruses in Africa and evidence for East Africa being a center of diversity of cassava geminiviruses" pptx

... KSGGGTCGACGTCATCAATGA CGTTRTAC AARGAATTCATKGGGGCCCA RARRGACTGGC GTGACGAAGATTGCATTCT AATAGTATTGTCATAGAAG TAAGAAGATGGTGGGAATCC CGATCAGTATTGTTCTGGAAC TGGTGGGAATCCCACCTT GTATTGTTATGGAAGGTGATA TATATGATGATGTTGGTC ... GAACCGGGA ACGTCTAGAACAATACTGATC GGTCTC GTGCTCTAGAAGGTGATAGC CGAACCGGGA GCGCGGAATCACTTGTGAAG CAGTCGT GCCGGGATTCGGTGAGTGGT TTACATCAC TACATCGGCCTTTGAGTCGC ATGG CTTATTAACGCCTATATAAAC ACC KSGGGTCGACGTCATCAATGA ... (EACMV), East African cassava mosaic Cameroon virus (EACMCV), East African cassava mosaic Malawi virus (EACMMV), East African cassava mosaic Zanzibar virus (EACMZV) and South African cassava...

Ngày tải lên: 18/06/2014, 22:20

23 613 0
phillips a.c. introduction to quantum mechanics

phillips a.c. introduction to quantum mechanics

... mechanics of a particle in a central potential Quantum mechanics of a particle in a central potential Quantum Mechanics of the Hydrogen Atom Energy levels and eigenfunctions Sizes and Shapes Radiative ... Classical magnets Quantum magnets Magnetic energies and the Stern±Gerlach experiment Orbital Angular Momentum Classical orbital angular momentum Quantum orbital angular momentum Angular shape of ... togetherness of distant objects are that: (1) the initial state of the gloves is a superposition of right and left-handedness, in much the same way as the state of a quantum particle can be a linear...

Ngày tải lên: 24/04/2014, 17:12

284 271 0
The Quantum Mechanics Solver 28 docx

The Quantum Mechanics Solver 28 docx

... potential U0 sin2 (k0 x) a wave packet in the n = band with a sharp distribution in q, and that we apply to the atom a constant extra force F = ma We recall the adiabatic theorem: suppose that a system ... on linearly the potential U0 until it reaches the value ER What is the condition on the time τ of the operation in order for the process to remain adiabatic? Calculate the minimal value of τ for ... = − The diagonalization of the matrix U0 −1 −1 gives the two eigenvalues 3U0 /4 and U0 /4, which means that the two bands n = and n = not touch each other anymore, but that they are separated...

Ngày tải lên: 02/07/2014, 07:20

15 275 0
The Quantum Mechanics Solver 1 ppsx

The Quantum Mechanics Solver 1 ppsx

... Delande for Quantum reflection of atoms on a surface” and Quantum motion in a periodic potential” Palaiseau, April 2005 Jean-Louis Basdevant Jean Dalibard Contents Summary of Quantum Mechanics ... given to the physical aspects of the phenomena rather than to analytical or computational considerations Many fundamental questions raised since the very beginnings of quantum theory have received ... of quantum mechanics and its philosophical implications Teaching quantum mechanics relies mostly on theoretical courses, which are illustrated by simple exercises often of a mathematical character...

Ngày tải lên: 02/07/2014, 07:20

10 340 0
The Quantum Mechanics Solver 2 docx

The Quantum Mechanics Solver 2 docx

... Summary of Quantum Mechanics Measurement To a given physical quantity A one associates a self-adjoint (or Hermitian) ˆ operator A acting in the Hilbert space In a measurement of the quantity A, ... identical and independent, and are all prepared in the same state |ψ (we assume N 1) For N of them, we measure a physical quantity A, and for the N others , we measure a physical quantity B The ... Summary of Quantum Mechanics In the following pages we remind the basic definitions, notations and results of quantum mechanics Principles Hilbert Space The first step in treating a quantum physical...

Ngày tải lên: 02/07/2014, 07:20

10 315 0
The Quantum Mechanics Solver 3 docx

The Quantum Mechanics Solver 3 docx

... general case We will analyze the data obtained with nuclear reactors The average energy of the (anti-)neutrinos produced in reactors is E = MeV, with a dispersion of the same order In all what ... plane wave eik·r and a scattered wave Such a state is called a stationary scattering state The scattering amplitude f depends on the energy, on the incident direction u = k/k, and on the final ... the normalization factors of the states |i and |f ) Consider an atomic transition treated as a two-level system, an excited state |e and a ground state |g , separated by an energy hω and ¯ coupled...

Ngày tải lên: 02/07/2014, 07:20

10 301 0
The Quantum Mechanics Solver 4 doc

The Quantum Mechanics Solver 4 doc

... cavity Cold atoms Fig 2.1 Sketch of the principle of an atomic clock with an atomic fountain, using laser-cooled atoms 2.2 The Atomic Fountain 31 2.2 The Atomic Fountain The atoms are initially ... that H splits the ground state in two substates of energies E1 = E0 + Asn /2 and E2 = E0 − A( 1 + sn )/2 Recover the particular case of the hydrogen atom 2.1.4 What are the degeneracies of the ... modifies this ratio Naturally, this effect is taken into account in an accurate treatment of the data 1.2.5 For an energy of GeV, we have found that the minimum distance to observe the oscillation resulting...

Ngày tải lên: 02/07/2014, 07:20

10 250 0
The Quantum Mechanics Solver 5 pps

The Quantum Mechanics Solver 5 pps

... beam is along the y axis, the z axis is in the ABCD plane, and the x axis is perpendicular to this plane We assume that the spin variables and the space variables are uncorrelated, i.e at any ... gravitational effects 3.2.2 For an angle φ, we define the gravitational potential V to be V = along AC and V = V0 along BD (a) Calculate the difference ∆p of the neutron momenta in the beams AC and ... atom), these two eigenvalues are A/ 4 and − 3A/ 4 2.1.4 There are 2sn × matrices to be diagonalized, each of which gives a vector associated to Asn /2 and a vector associated to A( 1 + sn )/2 In addition...

Ngày tải lên: 02/07/2014, 07:20

10 292 0
The Quantum Mechanics Solver 6 pdf

The Quantum Mechanics Solver 6 pdf

... v and a? The existence of this width puts a limit on the accuracy of the measurement of ω0 , and therefore of γ Is there an explanation of this on general grounds? 4.1.3 On the path of the beam, ... important to locate the exact position of the maximum of the peak Multiplying the width of the peak by a factor a/ b ( since a b) results in a major improvement of the measurement accuracy Of course ... probability has a resonant behavior as a function of the applied angular frequency ω Plot P−+ as a function of the distance from the resonance ω − ω0 How does the width of the resonance curve vary...

Ngày tải lên: 02/07/2014, 07:20

10 250 0
The Quantum Mechanics Solver 7 pdf

The Quantum Mechanics Solver 7 pdf

... before the slit, and that the vertical extension δ of the beam on the detector is the sum of the width a of the slit and the width of the diffraction peak Show that one can choose a in an optimal way ... space and in time The Stern–Gerlach experiment is actually a very good example of a measuring apparatus in quantum mechanics since it transfers quantum information – here the spin state of the ... of the field gradient, or the length of the apparatus, etc., but the particular combination of the product of the energy transferred to the system and the interaction time of the system with the...

Ngày tải lên: 02/07/2014, 07:20

10 246 0
The Quantum Mechanics Solver 8 pptx

The Quantum Mechanics Solver 8 pptx

... 7.1.3 Calculate the expectation value E of the energy of the electron after the decay One can for instance make use of the fact that: ψ0 | 1 |ψ0 = r a1 e2 ˆ ˆ H2 = H − r and Give the value of E ... Write the Hamiltonian of the relative motion of the two particles in terms of their separation r and their relative momentum p 8.1.3 What are the energy levels of the system, and their degeneracies? ... this calculated value of A? 8.2.5 Actually, the possibility that the electron and the positron can annihiˆ late, leads to an additional contribution HA in the hyperfine Hamiltonian One ˆ A does...

Ngày tải lên: 02/07/2014, 07:20

10 262 0
The Quantum Mechanics Solver 9 pptx

The Quantum Mechanics Solver 9 pptx

... 3.2, as a function of the field B ¿From now on, we assume that the field is weak, i.e |x| = |8¯ ω/( 7A) | h 1, and we shall make the corresponding approximations (a) What are, as a function of x, the ... of the static fields E0 and B0 Knowing that ωe is a function of the principal quantum number n of the form: ωe = (3/2)f (n)Ωe , and that ω0 and Ωe are the constants introduced above, answer the ... due to the value of the wave function at the origin Altogether, this results in a factor of ∼ 22/2000 ∼ 1% for the ratio of hyperfine splittings H/(e+ e− ) (b) The numerical value of A is A= 12π...

Ngày tải lên: 02/07/2014, 07:20

10 239 0
The Quantum Mechanics Solver 10 ppsx

The Quantum Mechanics Solver 10 ppsx

... enormous advantage, from the medical point of view, of heavy ion beams These permit to attack and destroy tumors in a very accurate and localized manner, as opposed to γ rays which produce damages all ... the crucial parameter is the effective interaction time, and give a simple explanation of this effect 10.2 Energy Loss in Matter We assume in the following that the Hamiltonian of the atom is of ... comparatively recent years, it has allowed a major improvement in the medical treatment of tumors in the eyes (proton therapy) and in the brain (ion therapy) Owing to the factor 1/β , or equivalently...

Ngày tải lên: 02/07/2014, 07:20

10 275 0
The Quantum Mechanics Solver 11 pptx

The Quantum Mechanics Solver 11 pptx

... is basically the same as here As an example, Fig 11.1 presents experimental results obtained by A Aspect and his collaborators in 1982 It gives the variation of E(α, β) as a function of the difference ... for a series of experiments, the results of the measurements on the electron and the proton are later compared, that one can find this non-local character of quantum mechanics 11.3.4 Individually, ... this value, what is the state of the system after the measurement? Is the proton spin state a ected by the measurement of the electron spin? ˆ ˆ 11.2.2 Calculate the expectation values Seα and...

Ngày tải lên: 02/07/2014, 07:20

10 302 0
The Quantum Mechanics Solver 12 pptx

The Quantum Mechanics Solver 12 pptx

... in the state (12.3), but that Alice is actually dealing with a nonparadoxical “statistical mixture”, that is to say that half of the N systems are in the state |α and the other half in the state ... eigenstate of a with eigenvalue α: a| α = α|α ˆ ˆ 12.1.3 Calculate the expectation value of the energy in a quasi-classical state |α Calculate also the expectation values x and p and the root mean ... (12.3) and measures the momentum of each of these systems The measuring apparatus has a resolution δp such that: √ m¯ ω h δp p0 For N ments 1, draw qualitatively the histogram of the results of the...

Ngày tải lên: 02/07/2014, 07:20

10 189 0
w