... postsecondary educational attainment varies significantly at the state level, with a correlation coefficient of 0.47 indicating a relatively weak relationship This suggests that some states may exhibit ... (0.01) states being Arkansas, Louisiana, Mississippi, Ohio, and Texas States with less than a 5 percent error (0.05) are Alabama, Illinois, A univariate cluster analysis of bachelor’s degree attainment ... highlighting the broader implications of socioeconomic status on educational attainment.Parental or guardian educational attainment significantly influences children's foundational learning abilities long
Ngày tải lên: 20/10/2022, 11:36
... Louisiana, Mississippi, Ohio, and Texas States with less than a 5 percent error (0.05) are Alabama, Illinois, A univariate cluster analysis of bachelor’s degree attainment revealed that Massachusetts, ... retention rates GeoDa's bivariate analysis reveals a significant correlation between low bachelor’s degree attainment and high poverty levels in Alabama, Florida, Georgia, and Louisiana.Mississippi ... generations.The correlation between secondary and postsecondary education attainment varies significantly at the state level, with a correlation coefficient of 0.47 indicating a relatively weak relationship
Ngày tải lên: 20/10/2022, 11:37
DSpace at VNU: A new CE with contactless conductivity detection method for the determination of complex cationic compositions: Application to the analysis of pen inks
... (C4D) has been proven to be a feasible and suitable technique for the separation and determination of inorganic anions and cations Some well-known reasons are that CE is a clean, cheap and fast ... that of the separation medium, C4D is a good detection system for the determination of inorganic ions The particular case of the separation and determination of metal cations by CE-C4D has attracted ... providing qualitative and quantitative data of metals in inks by CE Certain inks may contain certain types of metals, which may be useful, for example, for their identification and classification Moreover,
Ngày tải lên: 16/12/2017, 08:48
When children are better (or at least more open-minded) learners than adults Developmental differences in learning the forms of causal relationships
... evidence. So children might actually be better at learning an unusual abstract causal principle than adults. In particular, they may find it easier to learn that causal relationships take an AND form Trang 6There is some reason to believe that children show this sort of superior flexibility in other ... children and adults. Adults appear to be strongly biased towards OR relationships and learn these relationships more easily than AND relationships, a pattern that is consistent with the prevalence of OR ... But there have been no studies showing whether children can learn abstract causal principles or comparing children and adults. In this paper, we show that 4-year-old children can learn abstract causal principles about the form of causal relationships,
Ngày tải lên: 17/10/2022, 23:12
Báo cáo y học: "Prediction of posttraumatic stress in fathers of children with chronic diseases or unintentional injuries: a six-months follow-up study" pps
... Diagnostic and Statistical Manual of Mental Disorders (DSM-IV) [8], learning that one's child has a life-threatening illness qualifies as a traumatic event Trau-matic events can be a single draTrau-matic ... for at least one month, and had to cause impairment in at least one domain of life [28] Stress appraisal Stress appraisal was assessed by two single items (appraisal of threat and appraisal of ... injuries Fathers' socioeconomic status was calculated by means of a score reflecting paternal occupation and maternal edu-cation (range 2–12 points) using a measure that has been shown to be a reliable
Ngày tải lên: 13/08/2014, 18:21
Báo cáo sinh học: "Genetic evaluation for a quantitative trait controlled by polygenes and a major locus with genotypes not or only partly known" doc
... p was estimated with (13!, which is a natural deduction from !14!. The linear model can be written in matrix notation as: Kinghorn et al (1993) assumed that Var(a ) = Var(a) = A - Q a and Var(e ... genetic paths (inbreeding loops), mating paths, or a combination of the 2 (marriage loops), eg, a sire mated to 2 genetically related dams Both inbreeding and marriage loops are common in animal breeding ... Consider a quantitative trait which is controlled by 1 autosomal major locus with 2 alleles, A and a, and many other unlinked loci with alleles of small effects Mendelian segregation is assumed for all
Ngày tải lên: 14/08/2014, 19:22
A novel meshfree smoothed least squares(SLS) method with applications to dielectrophoresis simulations
... general purpose software, many commercial software packages are made available nowadays e.g ABAQUS, ANSYS, etc The FEM has a solid mathematical basis due to the extensive work done in the past ... translation, fractionation of chemical and biological particles in fluid medium It is particularly suitable for applications at microscale fluidic device that can be fabricated by inexpensive fabrication ... different particles as bacteria from blood cells, but inadequate for many mammalian cell applications b) Field-flow fractionation Field-flow fractionation (FFF) (Wang et al., 1998; Huang et al.,
Ngày tải lên: 11/09/2015, 16:07
SKKN sáng kiến kinh ngiệm “improving english speaking skills through extracurrials activities – a pilot care with 10th graders at trieu son high school n0 2”
... Trang 1i ABBREVIATIONS TEFL: Teaching English as a Foreign Language CLT: Communicative Language Teaching EFL: English as a Foreign Language M.A: Master of Arts ECAs: Extracurricular activities ... The major mean of data collection is the evaluation forms for students Each evaluation form was constructed from two parts: part A for personal information and part B for content information ... extracurricular activities From ninety evaluation forms of the students, the researcher can see that all students like extracurricular activities All of them participated in at least two extracurricular
Ngày tải lên: 28/12/2016, 23:02
DSpace at VNU: A MULTIPLICITY RESULT FOR A CLASS OF EQUATIONS OF p-LAPLACIAN TYPE WITH SIGN-CHANGING NONLINEARITIES
... Mountain pass theorem in [3] combined with Ekeland’s variational principle in [5] they proved that problem (1.3)–(1.4) has at least two weak solutions Motivated by K Perera [10] and M Mih˘ailescu ... Vietnam National University, Hanoi, Vietnam Department of Mathematics, National University of Singapore, Science Drive 2, Singapore 117543 e-mail: bookworm vn@yahoo.com (Received 11 July 2008; accepted ... Department of Mathematics and Informatics, Quang Binh University, 312 Ly Thuong Kiet, Dong Hoi, Quang Binh, Vietnam e-mail: ntchung82@yahoo.com and QU ˆO´ C ANH NG ˆO Department of Mathematics, College
Ngày tải lên: 12/12/2017, 06:49
DSpace at VNU: A phylogeny of softshell turtles (Testudines: Trionychidae) with reference to the taxonomic status of the critically endangered, giant softshell turtle, Rafetus swinhoei
... ′- TGACTTGAARAACCAYCGTTG - 3′ Palumbi 1996 CB3 (r) 5′- GGCAAATAGGAAATATCATTC - 3′ Palumbi 1996 CB534 (f) 5′- GACAATGCAACCCTAACACG- 3′ Engstrom et al 2004 Tcytbthr (r) 5′- TTCTTTGGTTTACAAGACC - ... et al 2004 C1 (r) 5′- GTGAGTAGTGTATAGCTAGGAAT - 3′ This study C2 (f) 5 ′- CCATTTGATGAAACTTTGGAT - 3′ This study C3 (r) 5 ′- CGTAATATAGGCCTCGTCCGAT - 3′ This study C4 (f) 5 ′- CCTCACTATTCTTCATATGCA ... Cyclanorbis elegans (B) Cycloderma aubryi (B) Cycloderma frenatum (A) Lissemys scutata (A) Lissemys punctata (A) Lissemys ceylonensis Asia Asia, Africa Asia, America Asia, Australia Africa America
Ngày tải lên: 12/12/2017, 06:53
DSpace at VNU: A modified quasi-boundary value method for regularizing of a backward problem with time-dependent coefficient
... regularizing of a backward problem with time-dependent coefficient Pham Hoang Quan a , Dang Duc Trong b , Le Minh Triet a & Nguyen Huy Tuan a a Department of Mathematics and Applications , Saigon ... value method for regularizing of a backward problem with time-dependent coefficient Pham Hoang Quana*, Dang Duc Trongb , Le Minh Trietaand Nguyen Huy Tuanay a Department of Mathematics and Applications, ... “Content”) contained in the publications on our platform However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness,
Ngày tải lên: 16/12/2017, 01:20
DSpace at VNU: A model-independent Dalitz plot analysis of B-+ - - DK + - with D - K(S)(0)h(+)h(-) (h = pi, K) decays and constraints on the CKM angle gamma
... full data sample The analysis assumes an efficiency that is flat across each Dalitz plot bin In reality the efficiency varies, and this leads to a poten-tial bias in the determination of x±and y±, ... Calvo Gomez33,n, A Camboni33, P Campana18,35, A Carbone14,c, G Carboni21,k, R Cardinale19,i, A Cardini15, L Carson50, K Carvalho Akiba2, G Casse49, M Cattaneo35, Ch Cauet9, M Charles52, Ph Charpentier35, ... avoids any assumption about the nature of the intermediate resonances which contribute to the KS0h+h−final state; such an assumption leads to a system-atic uncertainty associated with the variation
Ngày tải lên: 16/12/2017, 03:40
DSpace at VNU: Identification of the pollution source of a parabolic equation with the time-dependent heat conduction
... that e nA(T) increases rather quickly when n becomes large Thus the exact data function g(x) must satisfy the property that g(x), sin nx de-cays rapidly But in applications, the input data ... from data measured at some points in a watershed The pollution source causes water contamination in some region In all industrial countries, groundwater pollution is a serious environmen-tal problem ... frequently appear, for example, as a control term for the parabolic equation In another context, this problem is called the identification of heat source; it has received considerable attention from many
Ngày tải lên: 16/12/2017, 03:46
DSpace at VNU: A node-based smoothed finite element method with stabilized discrete shear gap technique for analysis of Reissner-Mindlin plates
... the accuracy of approximate solutions and to stabilize shear force lations appearing in the triangular element, the stabilizationtechnique [59] can be used here The idea for the stabilization ... be the transverse displacement and the rotations about the y and x Trang 3Fig 1 a 3-Node triangularelement; b Local coordinates axes, see Fig.1, respectively We assume that the material is homogeneous ... considered as an alternative form of nodally integrated techniques in finite element tions [61–68] The crucial idea of these methods is toformulate a nodal deformation gradient via a weightedaverage
Ngày tải lên: 16/12/2017, 05:10
DSpace at VNU: A Study of the Sequence of Norm of Derivatives (or Primitives) of Functions Depending on Their Beurling Spectrum
... formula in Ha Huy Bang hhbang@math.ac.vn Vu Nhat Huy nhat huy85@yahoo.com 1 Institute of Mathematics, Vietnamese Academy of Science and Technology, 18 Hoang Quoc Viet Street, Cau Giay, Hanoi, ... Vietnam 2 Department of Mathematics, College of Science, Vietnam National University, 334 Nguyen Trai Street, Thanh Xuan, Hanoi, Vietnam Trang 2the Theory of Banach algebras: Let A be a unital Banach ... derivatives (or primitives) of functions by their Beurling spectrum in Banach spaces The Bernstein inequality for Banach spaces is also obtained Keywords Banach Spaces· Beurling spectrum Mathematics
Ngày tải lên: 16/12/2017, 06:18
DSpace at VNU: A decomposition approach via Fourier sine transform for valuing American knock-out options with rebates
... integrand evaluated atthe Gauss points By examining the integrands in (3.18), the average cost for evaluating anintegrand at a Gauss point at each time τn is about 8 (flops) Thus the cost for evaluating ... feature is activated To compensate for this potential risk, the knock-out feature isusually accompanied by a rebate, which is cash paid out to the option holder at if theoption is terminated early ... de-composition formula (3.23) with respect to the relevant parameter(s) As an illustrativeexample, we calculate explicitly Delta below Other hedging parameters can be calculated in a similar manner Proposition
Ngày tải lên: 16/12/2017, 08:06
DSpace at VNU: Observation of associated production of a Z boson with a D meson in the forward region
... collaboration E-mail: Ivan.Belyaev@cern.ch Abstract: A search for associated production of a Z boson with an open charm meson is presented using a data sample, corresponding to an integrated ... [29] are calculated in both cases at next-to-leading order The renormalisation and factorisation scales are set to the Z boson mass and varied by a factor of two to assess the theory uncertainty ... total probability that a charm quark hadronises into a given charm meson Reference [31] suggests that the hadronisation of charm quarks may lead to an enhancement of charm hadrons in the LHCb acceptance
Ngày tải lên: 16/12/2017, 08:30
DSpace at VNU: A nonlinear parabolic equation backward in time: Regularization with new error estimates
... Trang 1Contents lists available atScienceDirectNonlinear Analysis journal homepage:www.elsevier.com/locate/na A nonlinear parabolic equation backward in time: Regularization with new ... error estimates aDepartment of Mathematics, SaiGon University, 273 AnDuongVuong, HoChiMinh city, Viet Nam bDepartment of Mathematics, University of Natural Science, Vietnam National University, ... (5) As we know, mis a constant which will be easily selected appropriately as regularization parameter In [23],β()is also the regularization parameter However, in that paper, it is not easy
Ngày tải lên: 16/12/2017, 09:18
DSpace at VNU: A lithotrophic microbial fuel cell operated with pseudomonads-dominated iron-oxidizing bacteria enriched at the anode
... ensure that the catholyte was air-saturated (Pham et al., 2005) but did not evaporate fast A batch of operation for a reactor was timed from the moment right after the anolyte was replaced until ... 0.5 g NaCl l−1) At the beginning of each batch, this catholyte was An MFC operated with iron-oxidizing bacteria 585 Trang 8renewed completely During a batch, the cathode compart-ment was aerated, ... that can utilize ferrous iron as an inorganic electron donor and operate at neutral pHs Electrical currents were steadily generated at an average level of 0.6 mA (or 0.024 mA cm –2 of membrane
Ngày tải lên: 16/12/2017, 09:27
DSpace at VNU: A stabilized finite element method for certified solution with bounds in static and frequency analyses of piezoelectric structures
... in the area of academic research On another front of computational mechanics, a strain smooth-ing technique[19,20]was introduced by Chen et al.[19]for spatial stabilization of nodal integrated ... our stabilized NS-FEM and FEM can bound the solutions from both sides with complicated geometry as long as a triangular element mesh can be generated Taking variation and applying stationary condition ... of the patch It shows inTable 2 that the desired results gained by the present method with stabilization parametera¼ 0:05 match the exact solutions (other parameters are found to match as well,
Ngày tải lên: 16/12/2017, 10:39