from a mission to an architecture model

báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

báo cáo hóa học: " The agreement between workers and within workers in regard to occupational exposure to mercury in dental practice assessed from a questionnaire and an interview" potx

... in a mortar? If yes: In that case, when and for how many years? From year to year Have you mixed amalgam in a Dentomat? Yes-no Did you use a Dentomat (semi-automatic device) to prepare amalgam? ... copper amalgam? In what year did all your use of copper amalgam end* Have you worked with amalgam that was manually mixed in a mortar? yes-no Have you ever manually weighted mercury and alloy and ... Chicago, IL, USA) The concordance between participants who had worked in the same clinic regarding the years the participants started and ended the use of copper amalgam and Dentomat was analyzed...

Ngày tải lên: 20/06/2014, 00:20

8 423 0
báo cáo khoa học: " Translating clinicians'''' beliefs into implementation interventions (TRACII): A protocol for an intervention modeling experiment to change clinicians'''' intentions to implement evidence-based practice" pdf

báo cáo khoa học: " Translating clinicians'''' beliefs into implementation interventions (TRACII): A protocol for an intervention modeling experiment to change clinicians'''' intentions to implement evidence-based practice" pdf

... behavioural interventions to change professional practice Aims of this protocol The aims are 1) To develop interventions to change beliefs that have already been identified as antecedents to antibiotic ... for Antimicrobial Resistance N Engl J Med 1997, 337(441):446 Sharland M, Kendall H, Yeates D, Randall A, Hughes G, Glasziou P, Mant D: Antiobiotic prescribing in general practice and hos- Page ... despite the considerable resources devoted to this area, a consistent observation is that the transfer of research findings into practice is unpredictable and can be a slow and haphazard process This...

Ngày tải lên: 11/08/2014, 05:22

6 206 0
Tài liệu Converting a DataSet to an ADO Recordset docx

Tài liệu Converting a DataSet to an ADO Recordset docx

... ""; xmlDoc.LoadXml(adoXml); // Create a namespace manager for the XML document XmlNamespaceManager nm = new XmlNamespaceManager(xmlDoc.NameTable); // Add ADO prefixes nm.AddNamespace("s", "uuid:BDC6E3F0-6DA3-11d1 -A2 A3-00AA00C14882"); ... // Load the Orders data into a table in a DataSet DataSet ds = new DataSet( ); SqlDataAdapter da = new SqlDataAdapter(sqlText, ConfigurationSettings.AppSettings["Sql_ConnectString"]); da.Fill(ds, ... schema section and the data section The schema section is required and contains detailed metadata about each column in the table The data section contains an element for each row Column data is stored...

Ngày tải lên: 14/12/2013, 18:16

15 392 0
Tài liệu Exporting the Results of a Query to an Array pdf

Tài liệu Exporting the Results of a Query to an Array pdf

... (rowCount >= 0) nRows = Math.Min(nRows, rowCount); // Create an object array to hold the data in the table Array a = Array.CreateInstance(typeof(object), nRows, nCols); // Iterate over the collection ... GetRows(DataTable dt, Integer rowCount, Integer startRow, String[] colName); Parameters tableArray Returns an array of field values corresponding to the values in the columns and rows selected from ... the table dt The DataTable to convert to the array rowCount The number of rows to export to the array startRow The row number of the first row to export fields A string array containing the names...

Ngày tải lên: 26/01/2014, 10:20

5 311 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢) and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; forward primer ... (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse primer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPTB-NLD-I D45–47; forward primer ... amino acids) than that of other well characterized bipartite NLSs (Table 1) Searching SWISSPROT and standard databases by PROSITE, and analyzing data deposited at the PredictNLS server (http://maple.bioc...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
sensitivity analysis in practice a guide to assessing scientific models

sensitivity analysis in practice a guide to assessing scientific models

... SENSITIVITY ANALYSIS IN PRACTICE SENSITIVITY ANALYSIS IN PRACTICE A GUIDE TO ASSESSING SCIENTIFIC MODELS Andrea Saltelli, Stefano Tarantola, Francesca Campolongo and Marco Ratto Joint Research Centre ... simple model could well be seen as a composite (or synthetic) indicator camp by aggregating a set of standardised base indicators Pi with weights Ci (Tarantola et al., 2002; Saisana and Tarantola, ... estimation 6.5.4 Implementation of the method Putting Bayesian analysis and global SA to work: two spheres Putting Bayesian analysis and global SA to work: a chemical experiment 6.7.1 Bayesian...

Ngày tải lên: 03/06/2014, 02:01

232 387 0
a means to an end the biological basis of aging and death apr 1999

a means to an end the biological basis of aging and death apr 1999

... maximum lifespan, as far as we can tell, has not As the twentieth century draws to a close, cardiovascular disease and stroke, cancer and pneumonia account for three-quarters of all human deaths ... accidental death T h e gradual physical weakening that accompanies aging will make an animal more likely to be caught by a predator; diminished immune capacity can make us more suscep8 AGING S ... intake in a wide range of laboratory organisms from single-cell organisms through rats and mice—was found to increase maximal lifespan, in some cases up to double the normal maximum lifespan...

Ngày tải lên: 11/06/2014, 05:26

246 672 0
Describe a visit to an interesting exhibition ppt

Describe a visit to an interesting exhibition ppt

... radiant with joy On the walls, different patterns of modern paintings were hung: charcoal drawings, pencil drawings and oil paintings were on display Most of them reflect daily activities and ... into a world of imagination and dreams As I strolled through the exhibition halls, I heard the voices of lecturers who were telling the visitors about the artists and their works An oil painting ... brought me back into my happy and peaceful past, full of love and tenderness, among my dear ones Before leaving the exhibition halls, I bought the postcards of my favorite paintings to keep as souvenirs...

Ngày tải lên: 22/07/2014, 04:20

5 503 0
Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

Báo cáo khoa học: "A flexible radial increment taper equation derived from a process-based carbon partitioning model" pot

... were used to analyse parameter variability in relation with calendar year, silvicultural treatment and fertility 5.3.1 Amance site The trees are young and each annual stem growth unit was sampled ... stand, trees were selected: dominant, codominant and suppressed [16] 2.2 Amance site The second site was located at Amance, near Nancy The pure even-aged experimental stand (“s5”) of Picea abies ... It has only parameters that can be interpreted in terms of tree vigor and structure, and that can be related to environmental variations: Pf and Pr are related to total wood production, whereas...

Ngày tải lên: 08/08/2014, 14:20

14 486 0
báo cáo khoa học: "Computing genetic evaluations through application of generalized least squares to an animal model" pot

báo cáo khoa học: "Computing genetic evaluations through application of generalized least squares to an animal model" pot

... problems can then be applied to obtain the necessary variances and covariances for recursive prediction II The animal model The animal model is demonstrated here for - each animal has - each animal ... performance data from both evaluated and related animals The animal model has advantages over the separate sire and cow models : - for equivalent lity ; - - all non in sex-limited traits the sire’s ... vector of residuals, random with mean zero and variance Iu’ i is The breeding value of the k’&dquo; animal in a, can be represented as where a! and afare breeding values of the sire and dam of...

Ngày tải lên: 09/08/2014, 22:22

10 229 0
Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

... forward 5'GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGAC-3' and reverse 5'-CGGAATTCTGAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI site of the VSMP8 plasmid (a gift ... was purchased from Santa Cruz Biotechnology (Cat sc-7870), rabbit anti-mouse/human E-cadherin pAb was purchased from Boster Company (Cat BA0475) GAPDH mAb was purchased from Chemicon (Cat CB1001) ... analysis, βgal and immunofluorescent staining Tissue β-galactosidase (βgal) staining Organs were dissected from BLM or PBS treated transgenic mice and subjected to βgal staining Briefly, organs...

Ngày tải lên: 12/08/2014, 16:20

11 434 0
From interval analysis to taylor models an overview lohner

From interval analysis to taylor models an overview lohner

... enclosures from AWA (rectangular boxes) and COSY Infinity (nonlinear sets) are of similar quality Near the end of the integration domain, the enclosures from AWA start exploding While AWA aborts integration ... K Makino Rigorous analysis of nonlinear motion in particle accelerators PhD thesis, Michigan State University, 1998 [20] K Makino and M Berz Remainder differential algebras and their applications ... Corliss, and A Griewank, editors, Computational Differentiation: Techniques, Applications and Tools, pages 63–74 SIAM, Philadelphia, 1996 [21] K Makino and M Berz COSY INFINITY version Nuclear Instruments...

Ngày tải lên: 12/01/2014, 22:04

8 409 1
Tài liệu From Crow-Scaring to Westminster; an A doc

Tài liệu From Crow-Scaring to Westminster; an A doc

... Applegate was the contractor and foreman on this yard, on which was manufactured all kinds of ware My foreman was quite a skilled tradesman and he took great interest in me and set me to manufacture ... men again began to be restless and were anxious to have another try at organizing CHAPTER V 26 CHAPTER V DARE TO BE A UNION MAN In the autumn of 1889 the men in Norfolk began to want to form a ... struggle against tremendous odds should be, and I am certain will be, an encouragement and an inspiration to many whose opportunities and means of social service are greater than his have been And...

Ngày tải lên: 21/02/2014, 11:20

120 374 0
Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

Báo cáo khoa học: "Exploring Deterministic Constraints: From a Constrained English POS Tagger to an Efficient ILP Solution to Chinese Word Segmentation" ppt

... 47th Annual Meeting of the ACL and the 4th International Joint Conference on Natural Language Processing of the AFNLP, ACL ’09, pages 513–521 Mitch Marcus, Beatrice Santorini, and Mary Ann Marcinkiewicz ... AAAI, pages 412–418 C Kruengkrai, K Uchimoto, J Kazama, Y Wang, K Torisawa, and H Isahara 2009 An error-driven word-character hybrid model for joint chinese word segmentation and pos tagging ... words are generated with respect to the partially tagged character sequence A character tagged with B always occurs at the beginning of a possible word Table illustrates the constrained and raw...

Ngày tải lên: 07/03/2014, 18:20

9 427 0
Báo cáo khoa học: "From route descriptions to sketches: a model for a text-to-image translator" doc

Báo cáo khoa học: "From route descriptions to sketches: a model for a text-to-image translator" doc

... A. I Technical report 540, M.I.T Artificial Intelligence Laboratory, Cambridge, MA A Yamada, T Yamamoto, H Ikeda, T Nishida, and S Doshita 1992 Reconstructing spatial image from natural language ... made up of transfers and relays Relays are abstract points initiating transfers and may be "covered" by a turn Landmarks can be either associated with relays or with transfers More formally, a ... (landmarks), or a turn and a landmark, mentioned in the text immediately one after •the other Concerning the ambiguity related to the location of landmarks, one can either choose an arbitrary...

Ngày tải lên: 08/03/2014, 07:20

3 307 0
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx

... formation (1) and bridging or lamellar bone formation (2) An assessment of these results was made and agreed upon by AS, TY and NT Tartrate-resistant acid phosphatase (TRAP) staining After radiographical ... Kawaguchi N, Matsumoto S, Matsushita Y: Radiographic analysis of pasteurized autologous bone graft Skeletal Radiol 2003, 32:454-461 Rong Y, Sato K, Sugiura H, Ito T, Sakano S, Iwata H, Kimata ... radiographical examination, the femurs with the graft were decalcified with EDTA (ethylenediaminetetraacetic acid), and cut sagittally, then stained with hematoxylin and eosin and tartrate-resistant...

Ngày tải lên: 20/06/2014, 04:20

10 479 0
Báo cáo hóa học: "Research Article A Patch-Based Structural Masking Model with an Application to Compression" pdf

Báo cáo hóa học: "Research Article A Patch-Based Structural Masking Model with an Application to Compression" pdf

... as a free parameter that is adjusted to match TvC curves We too have left g as a free parameter 3.1.2 The Excitatory and Inhibitory Exponents p and q, and the Semisaturation Constant b The parameters ... estimation based on doubly stochastic models for quantized wavelet image data,” IEEE Transactions on Image Processing, vol 16, no 4, pp 967–981, 2007 A Said and W A Pearlman, A new, fast, and ... methods are available to code the actual image data The image may be compressed in a nonembedded fashion, where wavelet coefficient quantization indices are separated into a significance map, refinement...

Ngày tải lên: 22/06/2014, 00:20

22 384 0
Báo cáo hóa học: " Research Article SPRINT: A Tool to Generate Concurrent Transaction-Level Models from Sequential Code" potx

Báo cáo hóa học: " Research Article SPRINT: A Tool to Generate Concurrent Transaction-Level Models from Sequential Code" potx

... at references to A In the current implementation, a base variables must be a scalar, an array of scalars, a pointer to a scalar, or a pointer to an array of scalars, where a scalar is a variable ... pointer base variables are all scalar and array of scalar variables Heap locations are not analyzed; if a base variable can refer to a heap location, a report is generated the designer, who can take ... functions allow an array token to be constructed in and read from the channel, without copying the array to or from local data A scalar FIFO can be seen as a special case of a block FIFO, with array...

Ngày tải lên: 22/06/2014, 19:20

15 299 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... relevant information In short, an Ishikawa diagram can assist memory and the retrieval of relevant medical case reports and literatures Acknowledgements I would like to thank the Journal of Medical...

Ngày tải lên: 11/08/2014, 00:23

3 381 0
báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps

báo cáo khoa học: " The Washington Needle Depot: fitting healthcare to injection drug users rather than injection drug users to healthcare: moving from a syringe exchange to syringe distribution model" pps

... healthcare information as well as referral to treatment, detox, and counselling Secondly, the exchange approach was meant to recover as many used needles as possible Thirdly, an exchange approach ... Reduction: Come as you are Addictive Behaviors 1996, 21:779-788 Tang SY, Browne AJ: 'Race' matters: racialization and egalitarian discourses involving aboriginal people in the Canadian health care context ... unique to Canada Today, needle retrieval boxes are located in many public places such as the bathrooms at the famous San Diego SeaWorld attraction (see Figure 3) In fact, a culture change in...

Ngày tải lên: 11/08/2014, 18:21

12 460 0
w